Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00051599

Source Database: WormBase (WB)
Affected Genes: WBGene00002245(lag-1)
Genomic Alteration: WBGene00002245(lag-1)
Availability: unknown
Source References: EMPTY
Synonyms: ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV.
Notes: ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https:|"Made_by: Jian Chen"

Proper citation: RRID:WB-STRAIN:WBStrain00051599 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051596

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi294 II; bqSi1308 IV.
Notes: bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1308 [hlh-12p::FLP::SL2::mTagBFP2 + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mTagBFP2 in the distal tip cells. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00051596 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051636

Source Database: WormBase (WB)
Affected Genes: WBGene00006654(ttx-3)|WBGene00009100(rgef-1)
Genomic Alteration: WBGene00006654(ttx-3), WBGene00009100(rgef-1)
Availability: unknown
Source References: EMPTY
Synonyms: juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP].
Notes: juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma"

Proper citation: RRID:WB-STRAIN:WBStrain00051636 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051635

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: rjSi1 II.
Notes: rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https:

Proper citation: RRID:WB-STRAIN:WBStrain00051635 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051634

Source Database: WormBase (WB)
Affected Genes: WBGene00002957(let-858)|WBGene00003310(mir-82)
Genomic Alteration: WBGene00002957(let-858), WBGene00003310(mir-82)
Availability: unknown
Source References: EMPTY
Synonyms: mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X.
Notes: Made_by: Julie Knott and Marcus L. Vargas|"Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC."

Proper citation: RRID:WB-STRAIN:WBStrain00051634 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051584

Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00016485(meg-4)
Genomic Alteration: WBGene00001569(meg-3), WBGene00016485(meg-4)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi577 IV; meg-3(tm4259) meg-4(ax2026) X.
Notes: bqSi577 [myo-2p::GFP + unc-119(+)] IV. Germ granule defective, ~30 sterility. Express GFP in pharyngeal muscles. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343|"Made_by: Itai Toker"

Proper citation: RRID:WB-STRAIN:WBStrain00051584 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051621

Source Database: WormBase (WB)
Affected Genes: WBGene00003275(mir-47)|WBGene00003514(myo-2)|WBGene00005016(sqt-1)
Genomic Alteration: WBGene00003275(mir-47), WBGene00003514(myo-2), WBGene00005016(sqt-1)
Availability: unknown
Source References: EMPTY
Synonyms: mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I.
Notes: mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

Proper citation: RRID:WB-STRAIN:WBStrain00051621 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051587

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi294 II; bqSi852 IV.
Notes: bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi852 [ckb-3p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the somatic gonad and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the somatic gonad can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00051587 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051620

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00005016(sqt-1)|WBGene00077715(mir-1818)
Genomic Alteration: WBGene00003514(myo-2), WBGene00005016(sqt-1), WBGene00077715(mir-1818)
Availability: unknown
Source References: EMPTY
Synonyms: mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I.
Notes: mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]

Proper citation: RRID:WB-STRAIN:WBStrain00051620 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051586

Source Database: WormBase (WB)
Affected Genes: WBGene00003210(mel-28)
Genomic Alteration: WBGene00003210(mel-28)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi189 II; mel-28(bq17 [g>f>p::mel-28]) III.
Notes: bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the mel-28 start codon. FRT sites in GFP introns 2 & 3 are indicated by > symbols in genotype. Ubiquitous expression of mCherry::HIS-58. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00051586 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051625

Source Database: WormBase (WB)
Affected Genes: WBGene00002957(let-858)|WBGene00003039(mir-48)
Genomic Alteration: WBGene00002957(let-858), WBGene00003039(mir-48)
Availability: unknown
Source References: EMPTY
Synonyms: mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V.
Notes: Made_by: Julie Knott & Marcus Vargas|"Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG."

Proper citation: RRID:WB-STRAIN:WBStrain00051625 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051589

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: bqSi294 II; bqSi1021 IV.
Notes: bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1021 [lin-31p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in P1.p-P11.p and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in P1.p-P11.p can mask GFP::HIS-58 signal. May carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00051589 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051570

Source Database: WormBase (WB)
Affected Genes: WBGene00009073(delm-1)|WBGene00016063(delm-2)|WBGene00016064(acd-1)
Genomic Alteration: WBGene00009073(delm-1), WBGene00016063(delm-2), WBGene00016064(acd-1)
Availability: unknown
Source References: PMID:37118502
Synonyms: acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV.
Notes: acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.|"Made_by: Lauren Booth"

Proper citation: RRID:WB-STRAIN:WBStrain00051570 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051614

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: unc-119(ed3) III; kstSi37 IV; kstEx46.
Notes: kstSi37 [Cbr-unc-119(kst13)] IV. kstEx46 [hsp-16.41p::Cas9::gpd-2::TagRFP-T::smu-1 3'UTR + mlc-1p::mCherry + NeoR]. Pick mCherry+ to maintain. Unc. Cbr-unc-119(kst13) is a partial unc-119 used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Reference: El Mouridi S, et al. 2022.

Proper citation: RRID:WB-STRAIN:WBStrain00051614 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051612

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: kstSi84 I; unc-119(ed3) III.
Notes: kstSi84 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] I. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.

Proper citation: RRID:WB-STRAIN:WBStrain00051612 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051578

Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00016485(meg-4)
Genomic Alteration: WBGene00001569(meg-3), WBGene00016485(meg-4)
Availability: unknown
Source References: EMPTY
Synonyms: mjIs134 II; meg-3(tm4259) meg-4(ax2026) X.
Notes: Made_by: Itai Toker|"mjIs134 [mex-5p::GFP::(Gly)5Ala::his-58::tbb-2 3'UTR + Cbr-unc-119(+)] II. Germ granule defective. ~30% sterility, maintain by picking gravid adults with visible embryos. Nuclear GFP expression in the germline. Reference: Lev I, et al. Curr Biol. 2019 Sep 9;29(17):2880-2891.e4. PMID: 31378614"

Proper citation: RRID:WB-STRAIN:WBStrain00051578 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051611

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: kstSi61 II; unc-119(ed3) III.
Notes: kstSi61 [LoxP + Cbr-unc-119(+) + LoxP + hygroR(kst31)] II. N2-like, no hygromycin resistance (HygroR). hygroR(kst31) is a partial, non-functional hygromycin-resistance construct used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.

Proper citation: RRID:WB-STRAIN:WBStrain00051611 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051617

Source Database: WormBase (WB)
Affected Genes: WBGene00001182(egl-13)|WBGene00002957(let-858)|WBGene00003335(mir-241)
Genomic Alteration: WBGene00001182(egl-13), WBGene00002957(let-858), WBGene00003335(mir-241)
Availability: unknown
Source References: EMPTY
Synonyms: mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V.
Notes: Made_by: Marcus Vargas & Julie Knott|"Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG."

Proper citation: RRID:WB-STRAIN:WBStrain00051617 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051561

Source Database: WormBase (WB)
Affected Genes: WBGene00004143(pqn-59)
Genomic Alteration: WBGene00004143(pqn-59)
Availability: unknown
Source References: PMID:34661238
Synonyms: pqn-59::ollas::STOP(cz2)
Notes: Batch Strain object requested via get_NS_ids.pl

Proper citation: RRID:WB-STRAIN:WBStrain00051561 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00051566

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ldIs7[skn-1b/c::GFP; rol-6(su1006)]
Notes: [2022-05-02T21:36:56.545Z WBPerson712] New Strain: lsIs7[skn-1b/c::GFP + rol-6(su1006)]|"[2022-05-02T21:39:29.432Z WBPerson712] Kill Strain: typo in genotype"|"[2022-05-02T21:40:28.377Z WBPerson712] Ressurect Strain: yes, genotype should be ldIs7[skn-1b/c::GFP; rol-6(su1006)]"

Proper citation: RRID:WB-STRAIN:WBStrain00051566 Copy   

•   Source: Integrated Animals