Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Species:caenorhabditis elegans (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

62,713 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RB2015
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032699 Caenorhabditis elegans acs-5(ok2668) III. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y76A2B.3 Homozygous. Outer Left Sequence: aacaacacgttgctggagtg. Outer Right Sequence: ccacccatggcctaactcta. Inner Left Sequence: tctaatcgagttggattcacg. Inner Right Sequence: tgcaattacagggtcaacca. Inner Primer PCR Length: 3069. Deletion size: about 1700 bp." WBGene00013575(acs-5) WBGene00013575(acs-5) WB-STRAIN:WBStrain00032699 WormBase (WB) WB available WB-STRAIN:RB2015, CGC_RB2015 2026-08-29 09:21:46 0
RB1925
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032610 Caenorhabditis elegans C49G9.1(ok2504) I. C49G9.1. Homozygous. Outer Left Sequence: TTTTAAGCCATAACACCCGC. Outer Right Sequence: ATGCATCGACGAATACACCA. Inner Left Sequence: CCAGGAAATTGTCAACACGA. Inner Right Sequence: ATCCCTTCCTCCACATCTCA. Inner Primer PCR Length: 1210 bp. Deletion Size: 385 bp. Deletion left flank: TAAGGATTTGATAATTTCATGAAAATTAAA. Deletion right flank: ATCCAAATTTTTTTTTTCCAAAATTTTTTT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00008216(mec-19) WBGene00008216(mec-19) WB-STRAIN:WBStrain00032610 WormBase (WB) WB available WB-STRAIN:RB1925, CGC_RB1925 2026-08-29 09:21:44 0
RB1934
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032619 Caenorhabditis elegans W07B8.4(ok2537) V. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp." WBGene00021072(W07B8.4) WBGene00021072(W07B8.4) WB-STRAIN:WBStrain00032619 WormBase (WB) WB available WB-STRAIN:RB1934, CGC_RB1934 2026-08-29 09:21:45 0
RB1941
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032626 Caenorhabditis elegans rbr-2(ok2544) IV. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG." WBGene00004319(rbr-2) WBGene00004319(rbr-2) WB-STRAIN:WBStrain00032626 WormBase (WB) WB available WB-STRAIN:RB1941, CGC_RB1941 2026-08-29 09:21:45 0
RB1939
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032624 Caenorhabditis elegans C50A2.2(ok2542) IV. C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00016796(cec-2) WBGene00016796(cec-2) WB-STRAIN:WBStrain00032624 WormBase (WB) WB available WB-STRAIN:RB1939, CGC_RB1939 2026-08-29 09:21:45 0
RB1936
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032621 Caenorhabditis elegans M28.4(ok2539) II. M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010895(M28.4) WBGene00010895(M28.4) WB-STRAIN:WBStrain00032621 WormBase (WB) WB available WB-STRAIN:RB1936, CGC_RB1936 2026-08-29 09:21:45 0
RB1944
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032629 Caenorhabditis elegans M01E5.2(ok2552) I. Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT."|"ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010805(M01E5.2) WBGene00010805(M01E5.2) WB-STRAIN:WBStrain00032629 WormBase (WB) WB available WB-STRAIN:RB1944, CGC_RB1944 2026-08-29 09:21:45 0
RB1990
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00032674 Caenorhabditis elegans flp-7(ok2625) X. F49E10.3. Homozygous. Outer Left Sequence: GAAGGCGGAGTCATAGCATC. Outer Right Sequence: TGAAGGACTGGAAAACAGGC. Inner Left Sequence: ATGAGAAGAAGGGGGTGGAG. Inner Right Sequence: TTGGGTAGCGACCAATCTGT. Inner Primer PCR Length: 1302 bp. Deletion Size: 548 bp. Deletion left flank: TCCTATTTTTTCTATTTTTTATATTTTTCA. Deletion right flank: TGCAAACACCTTGATTACCAAGAACAAAAC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001450(flp-7) WBGene00001450(flp-7) WB-STRAIN:WBStrain00032674 WormBase (WB) WB available WB-STRAIN:RB1990, CGC_RB1990 2026-08-29 09:21:45 4
RB1989
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00032673 Caenorhabditis elegans flp-10(ok2624) IV. Made_by: OMRF Knockout Group|"Supplementary_genotype flp-10(ok2624)"|"T06C10.4. Homozygous. Outer Left Sequence: CCTATGATCCAAGCCCTCAA. Outer Right Sequence: AAAACTTGACGACTGGTGGG. Inner Left Sequence: TCCAATTAACGTTTATGACCGA. Inner Right Sequence: GCATGATGACGTGGATTTTG. Inner Primer PCR Length: 1168 bp. Deletion Size: 682 bp. Deletion left flank: CCCATCTCACTAATTATACGCCTAAATCTT. Deletion right flank: ACATTCGATTCGGAAAACGAAGAGTCGATC."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001453(flp-10) WBGene00001453(flp-10) WB-STRAIN:WBStrain00032673 WormBase (WB) WB available PMID:37769660 WB-STRAIN:RB1989, CGC_RB1989 2026-08-29 09:21:45 2
RB1986
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032670 Caenorhabditis elegans Y111B2A.19(ok2620) III. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y111B2A.19 Homozygous. Outer Left Sequence: attttcggtaatttgccggt. Outer Right Sequence: aaaattacgctccgcctctt. Inner Left Sequence: tctgccagtttgctggaaat. Inner Right Sequence: tgcgcgacgctacttataga. Inner Primer PCR Length: 3222. Deletion size: about 1700 bp." WBGene00013739(spin-4) WBGene00013739(spin-4) WB-STRAIN:WBStrain00032670 WormBase (WB) WB available WB-STRAIN:RB1986, CGC_RB1986 2026-08-29 09:21:45 0
RB1995
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032679 Caenorhabditis elegans F35E2.1(ok2630) I. F35E2.1. Homozygous. Outer Left Sequence: TGCGGATCTTGTTGTCTGAG. Outer Right Sequence: ATGGAACTTGTTCGGGTGAG. Inner Left Sequence: AAGGCGTATGTCCGAAGATG. Inner Right Sequence: CAATTGATTTGTAGACTGATTGGAA. Inner Primer PCR Length: 1374 bp. Deletion Size: 311 bp. Deletion left flank: ACTCTCTCATAGTTTATAGTGTGGGAAAGT. Deletion right flank: TTTGGGAAACATCCACATAAAGCTGTATCC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009409(F35E2.1) WBGene00009409(F35E2.1) WB-STRAIN:WBStrain00032679 WormBase (WB) WB available WB-STRAIN:RB1995, CGC_RB1995 2026-08-29 09:21:46 0
RB1993
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032677 Caenorhabditis elegans C06B3.3(ok2628) V. C06B3.3 Homozygous. Outer Left Sequence: ggcaaagatcacaattccgt. Outer Right Sequence: tgggaatgggaagagatttg. Inner Left Sequence: aaggcttcgcatctcttgg. Inner Right Sequence: tgcaaggtaccattaaccga. Inner Primer PCR Length: 1208. Deletion size: about 700 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00007362(cyp-35C1) WBGene00007362(cyp-35C1) WB-STRAIN:WBStrain00032677 WormBase (WB) WB available PMID:31898444 WB-STRAIN:RB1993, CGC_RB1993 2026-08-29 09:21:46 0
RB2002
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032686 Caenorhabditis elegans F41E7.2(ok2647) X. F41E7.2 Homozygous. Outer Left Sequence: aatgccaactatgattcgcc. Outer Right Sequence: tctcgcggatacaaagacct. Inner Left Sequence: aagaacagggaatcggaacc. Inner Right Sequence: ttctctcctcgttccacctc. Inner Primer PCR Length: 3078. Deletion size: about 1500 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00009618(F41E7.2) WBGene00009618(F41E7.2) WB-STRAIN:WBStrain00032686 WormBase (WB) WB available PMID:38302462 WB-STRAIN:RB2002, CGC_RB2002 2026-08-29 09:21:46 0
RB2001
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032685 Caenorhabditis elegans F52E10.3(ok2646) X. F52E10.3. Homozygous. Outer Left Sequence: TCGGACTCCTGTTCGCTAGT. Outer Right Sequence: TGGCAGTTTCTCTTCTCCGT. Inner Left Sequence: CAACGGGCATCTTTGTAATCT. Inner Right Sequence: GGATTTATGGCTCTCACCCA. Inner Primer PCR Length: 1229 bp. Deletion Size: 533 bp. Deletion left flank: GTGGAAATTCGTTTTCAGTAGGGCGTATTT. Deletion right flank: TAATATTTTTAAATTCAAGTTATAAGCATT. Insertion Sequence: TT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WB-STRAIN:WBStrain00032685 WormBase (WB) WB available WB-STRAIN:RB2001, CGC_RB2001 2026-08-29 09:21:46 0
RB2000
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032684 Caenorhabditis elegans maoc-1&E04F6.6(ok2645) II. E04F6.3, E04F6.6. Homozygous. Outer Left Sequence: AACGATGGAGAGGAAACGTG. Outer Right Sequence: TGAACCACGTCCAGAAGATG. Inner Left Sequence: GGACGGTCATTGTTATCTCTTG. Inner Right Sequence: CGGTGGGAATAAGACAGAGG. Inner Primer PCR Length: 3145 bp. Deletion Size: 2110 bp. Deletion left flank: ATACTTTTTTTGCAAATTATTTAAAACATC. Deletion right flank: AGTAAAACCATTCAAATATAATATAAATTC. Insertion Sequence: AGTAAAAACGTC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00017123(maoc-1)|WBGene00017126(E04F6.6) WBGene00017123(maoc-1), WBGene00017126(E04F6.6) WB-STRAIN:WBStrain00032684 WormBase (WB) WB available WB-STRAIN:RB2000, CGC_RB2000 2026-08-29 09:21:46 0
RB1999
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00032683 Caenorhabditis elegans grl-7(ok2644) V. Made_by: OMRF Knockout Group|"T02E9.2. Homozygous. Outer Left Sequence: AGACCCTCCGTACCTGGTTT. Outer Right Sequence: CTTTGAATGGCAGTGTGACG. Inner Left Sequence: AAGCTCGGAAGCGTGCTG. Inner Right Sequence: CTATTGCATAACCGCCCATC. Inner Primer PCR Length: 1207 bp. Deletion Size: 424 bp. Deletion left flank: CGATTCCTGAGCTGTAGCAACTTCCGCGAC. Deletion right flank: CGGAATAGCATTCTGGAAATAGAATCAACA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001716(grl-7) WBGene00001716(grl-7) WB-STRAIN:WBStrain00032683 WormBase (WB) WB available WB-STRAIN:RB1999, CGC_RB1999 2026-08-29 09:21:46 2
RB1998
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032682 Caenorhabditis elegans hog-1(ok2643) X. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W06B11.4. Homozygous. Outer Left Sequence: TGAAGCTAATGCTGAACCGA. Outer Right Sequence: CAGTACAAACGGCTGCACAT. Inner Left Sequence: TTGTGGCCTAAAATGCAAAA. Inner Right Sequence: TCATGCTTGTTTTTCTACCGA. Inner Primer PCR Length: 1280 bp. Deletion Size: 487 bp. Deletion left flank: GTAGTTTTCTAAAATTTTATTGTTAACAGT. Deletion right flank: AGATAAGATGTTTTGCAGATACAGCGAGCA." WBGene00001984(hog-1) WBGene00001984(hog-1) WB-STRAIN:WBStrain00032682 WormBase (WB) WB available WB-STRAIN:RB1998, CGC_RB1998 2026-08-29 09:21:46 0
RB1997
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032681 Caenorhabditis elegans mtr-4(ok2642) IV. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W08D2.7. Homozygous. Outer Left Sequence: CAGCTCACACATCTGCTGGT. Outer Right Sequence: AGAGCATCATCGTTTCCCAG. Inner Left Sequence: CGTCTCCAATCAAAGCACTG. Inner Right Sequence: CACTTTTTCTTTCGGCTTTCA. Inner Primer PCR Length: 3060 bp. Deletion Size: 1554 bp. Deletion left flank: CTTAAAATATTTTTAACTTCAGAATGGGTC. Deletion right flank: AAAGAATTATTCAAATTCAACGAGAACCCA." WBGene00012342(mtr-4) WBGene00012342(mtr-4) WB-STRAIN:WBStrain00032681 WormBase (WB) WB available WB-STRAIN:RB1997, CGC_RB1997 2026-08-29 09:21:46 0
RB1921
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032606 Caenorhabditis elegans clc-1(ok2500) X. C09F12.1 Homozygous. Outer Left Sequence: gcacgttgccattccttatt. Outer Right Sequence: catccccgagaggtccttat. Inner Left Sequence: ttgcatagatgccaccatgt. Inner Right Sequence: atctttaacccatccgcctt. Inner Primer PCR Length: 2240. Deletion size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"no longer available from the CGC"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000522(clc-1) WBGene00000522(clc-1) WB-STRAIN:WBStrain00032606 WormBase (WB) WB available WB-STRAIN:RB1921, CGC_RB1921 2026-08-29 09:21:44 0
RB1918
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00032603 Caenorhabditis elegans sedl-1(ok2497) X. Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W05H7.3. Homozygous. Outer Left Sequence: CTTTTCAACCGGTTTTGCAT. Outer Right Sequence: CGACTAAGAGAGCCCGTGTC. Inner Left Sequence: TTCCTGTGAGAAAAATCCCG. Inner Right Sequence: GATGAGCCAAGCTTAGTGGC. Inner Primer PCR Length: 2915 bp. Deletion Size: 1236 bp. Deletion left flank: AAACTAAATTCAGAAAATATTTTTGGCTTC. Deletion right flank: TATTCAGAAATCAACTGGGCTGATGATACC." WBGene00021046(sedl-1) WBGene00021046(sedl-1) WB-STRAIN:WBStrain00032603 WormBase (WB) WB available WB-STRAIN:RB1918, CGC_RB1918 2026-08-29 09:21:44 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.