Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ceh-53(ot1066) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055007 | Caenorhabditis elegans | ceh-53(ot1066) IV. | Made_by: Burcu Gulez (Hobert Lab)|"ot1066 is an engineered deletion of the full ceh-53 locus. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425" | WBGene00015651(ceh-53) | WBGene00015651(ceh-53) | WB-STRAIN:WBStrain00055007 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
jsSi1973 I; him-8(e1489) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054953 | Caenorhabditis elegans | jsSi1973 I; him-8(e1489) IV. | jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab" | WBGene00001867(him-8) | WBGene00001867(him-8) | WB-STRAIN:WBStrain00054953 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
jsSi1962 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054945 | Caenorhabditis elegans | jsSi1962 I. | jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab" | WB-STRAIN:WBStrain00054945 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
jsSi1978 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054947 | Caenorhabditis elegans | jsSi1978 V. | jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab" | WB-STRAIN:WBStrain00054947 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||||
|
jsSi1971 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054946 | Caenorhabditis elegans | jsSi1971 I. | jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab" | WB-STRAIN:WBStrain00054946 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
jsSi1727 I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054940 | Caenorhabditis elegans | jsSi1727 I. | jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https: | WB-STRAIN:WBStrain00054940 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
jsSi1900 II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054943 | Caenorhabditis elegans | jsSi1900 II. | jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https:|"Made_by: Nonet Lab" | WB-STRAIN:WBStrain00054943 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
jsSi1837 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054942 | Caenorhabditis elegans | jsSi1837 IV. | jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https: | WB-STRAIN:WBStrain00054942 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:45 | 0 | ||||||
|
dpy-20(e1282) IV; pkIs1275. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054938 | Caenorhabditis elegans | dpy-20(e1282) IV; pkIs1275. | Made_by: Plasterk lab|"pkIs1275 [gpc-2::GFP + dpy-20(+)]. Reporter construct includes 2.3 kbp of upstream sequence and most of the gpc-2 open reading frame. 2.5 kbp PCR fragment generated with primers gpc2-1 (TCTGCAGCACGACGATAATC, extended with a SphI site) and gpc2-2 (GTCGATTGGGTTCACAAGTG, extended with a BamHI site) into vector pPD95.77. Reference: Jansen G, et al. EMBO J. 2002 Mar 1;21(5):986-94." | WBGene00001079(dpy-20) | WBGene00001079(dpy-20) | WB-STRAIN:WBStrain00054938 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
flp-11(syb1433[flp-11::SL2::egl-23(cDNA)(A383V)::linker::mKate2]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055058 | Caenorhabditis elegans | flp-11(syb1433[flp-11::SL2::egl-23(cDNA)(A383V)::linker::mKate2]) X. | egl-23 cDNA(A383V) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes moderate inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https:|"Made_by: Bringmann lab" | WBGene00001190(egl-23)|WBGene00001454(flp-11) | WBGene00001190(egl-23), WBGene00001454(flp-11) | WB-STRAIN:WBStrain00055058 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055057 | Caenorhabditis elegans | hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. | Made_by: SunyBiotech|"mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281" | WB-STRAIN:WBStrain00055057 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||||
|
pha-1(e2123) III; otEx8047. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055054 | Caenorhabditis elegans | pha-1(e2123) III; otEx8047. | Made_by: Daniel Merritt|"otEx8047 [pks-1p::TagRFP + pha-1(+)]. Maintain at 25C to select for array. TagRFP expression marks CAN neurons." | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00055054 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
unc-75(ot1351) I; ceh-44(ot1015[ceh-44::GFP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055055 | Caenorhabditis elegans | unc-75(ot1351) I; ceh-44(ot1015[ceh-44::GFP]) III. | Made_by: Michael Cesar|"ot1351 is a CRISPR-engineered deletion of unc-75 gene rendering all 3 RNA recognition motifs null on unc-75; reduces pan-neuronal nuclear GFP expression fluorescence. GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Please contact Oliver Hobert prior to publishing work using this strain." | WBGene00000464(ceh-44)|WBGene00006807(unc-75) | WBGene00000464(ceh-44), WBGene00006807(unc-75) | WB-STRAIN:WBStrain00055055 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
mod-1(syb1841[mod-1::T2A::mNeonGreen]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055061 | Caenorhabditis elegans | mod-1(syb1841[mod-1::T2A::mNeonGreen]) V. | Endogenous mod-1 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https:|"Made_by: Steve Flavell" | WBGene00003386(mod-1) | WBGene00003386(mod-1) | WB-STRAIN:WBStrain00055061 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055046 | Caenorhabditis elegans | linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. | Made_by: Sandeep Wontakal|"The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad." | WBGene00005016(sqt-1)|WBGene00006537(tbb-2)|WBGene00194659(linc-1) | WBGene00005016(sqt-1), WBGene00006537(tbb-2), WBGene00194659(linc-1) | WB-STRAIN:WBStrain00055046 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
otIs669 V; nlp-66(syb4403[nlp-66:SL2:GFP::H2B])X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055049 | Caenorhabditis elegans | otIs669 V; nlp-66(syb4403[nlp-66:SL2:GFP::H2B])X. | GFP tag inserted at the C-terminus of the endogenous nlp-66 locus by CRISPR. Allele generated by SUNY Biotech. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https:|"Made_by: Suny Biotech" | WBGene00011141(nlp-66) | WBGene00011141(nlp-66) | WB-STRAIN:WBStrain00055049 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
puf-9(ot1236[puf-9::GFP::loxP::3xFLAG]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055042 | Caenorhabditis elegans | puf-9(ot1236[puf-9::GFP::loxP::3xFLAG]) X. | Made_by: Sandeep Wontakal|"SEC cassette was used to generate a C-terminal GFP tag of puf-9. Expression is cytoplasmic and pan-somatic throughout larval development into adults." | WBGene00004245(puf-9) | WBGene00004245(puf-9) | WB-STRAIN:WBStrain00055042 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
ttx-1(syb1679[ttx-1::GFP]) ot1264) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055050 | Caenorhabditis elegans | ttx-1(syb1679[ttx-1::GFP]) ot1264) V. | Made_by: Berta Vidal (Hobert lab)|"ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:" | WBGene00006652(ttx-1) | WBGene00006652(ttx-1) | WB-STRAIN:WBStrain00055050 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
pha-1(e2123) III; otIs355; otEx7950. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055052 | Caenorhabditis elegans | pha-1(e2123) III; otIs355; otEx7950. | Made_by: Wendy Cao|"otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. otEx7950 [clec-166::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Pan-neuronal nuclear RFP expression. Co-expression of GFP and TagRFP in M5 neuron can be used to isolate M5 by FACS. Used by CeNGEN project for RNA-Seq (https:" | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00055052 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055039 | Caenorhabditis elegans | linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. | Made_by: Sandeep Wontakal|"The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males." | WBGene00005016(sqt-1)|WBGene00006537(tbb-2)|WBGene00219694(linc-36) | WBGene00005016(sqt-1), WBGene00006537(tbb-2), WBGene00219694(linc-36) | WB-STRAIN:WBStrain00055039 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
