Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
unc-42(ot986[unc-42::gfp]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054999 | Caenorhabditis elegans | unc-42(ot986[unc-42::gfp]) V. | GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903.doi: 10.7554/eLife.64903. PMID: 34165428|"Made_by: Suny Biotech" | WBGene00006778(unc-42) | WBGene00006778(unc-42) | WB-STRAIN:WBStrain00054999 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
otIs742. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054998 | Caenorhabditis elegans | otIs742. | Made_by: Berta Vidal (Hobert Lab)|"otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"|"otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:" | WB-STRAIN:WBStrain00054998 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||||
|
otIs711. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054997 | Caenorhabditis elegans | otIs711. | Made_by: Berta Vidal (Hobert Lab)|"otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"|"otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:" | WB-STRAIN:WBStrain00054997 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||||
|
ltSi220 I; ltSi1232 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054981 | Caenorhabditis elegans | ltSi220 I; ltSi1232 II; unc-119(ed3) III. | ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00054981 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055035 | Caenorhabditis elegans | linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. | Made_by: Sandeep Wontakal|"The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers." | WBGene00005016(sqt-1)|WBGene00006537(tbb-2)|WBGene00219714(linc-3) | WBGene00005016(sqt-1), WBGene00006537(tbb-2), WBGene00219714(linc-3) | WB-STRAIN:WBStrain00055035 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
ltSi220 I; ltSi1561 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054983 | Caenorhabditis elegans | ltSi220 I; ltSi1561 II; unc-119(ed3) III. | ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00054983 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055032 | Caenorhabditis elegans | ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:"|"Made_by: Suny Biotech" | WBGene00001864(him-5)|WBGene00002113(ins-30) | WBGene00001864(him-5), WBGene00002113(ins-30) | WB-STRAIN:WBStrain00055032 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055031 | Caenorhabditis elegans | ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:"|"Made_by: Suny Biotech" | WBGene00001864(him-5)|WBGene00002107(ins-24) | WBGene00001864(him-5), WBGene00002107(ins-24) | WB-STRAIN:WBStrain00055031 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055034 | Caenorhabditis elegans | lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. | Made_by: Sandeep Wontakal|"The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails." | WBGene00005016(sqt-1)|WBGene00006537(tbb-2)|WBGene00010424(lep-5) | WBGene00005016(sqt-1), WBGene00006537(tbb-2), WBGene00010424(lep-5) | WB-STRAIN:WBStrain00055034 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||
|
otIs601. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054989 | Caenorhabditis elegans | otIs601. | otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain. | WB-STRAIN:WBStrain00054989 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||||
|
otIs597. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054988 | Caenorhabditis elegans | otIs597. | otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain. | WB-STRAIN:WBStrain00054988 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||||
|
ify-1(lt212[mNG::ify-1]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054984 | Caenorhabditis elegans | ify-1(lt212[mNG::ify-1]) II. | mNeonGreen tag inserted at 5' end of endogenous ify-1 locus using CRISPR/Cas9 engineering. gRNA sequence: catactcgcacaagtcaaaA | WBGene00002068(ify-1) | WBGene00002068(ify-1) | WB-STRAIN:WBStrain00054984 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
ltSi264 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054987 | Caenorhabditis elegans | ltSi264 II; unc-119(ed3) III. | ltSi264 [bub-1p::bub-1(re-encoded)::RFP + Cbr-unc-119(+)] II. BUB-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Pelisch F, et al. Mol Cell. 2017 Jan 5;65(1):66-77. doi: 10.1016/j.molcel.2016.11.001. PMID: 27939944|"Made_by: Arshad Desai lab" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00054987 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
egIs1; otIs860. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055025 | Caenorhabditis elegans | egIs1; otIs860. | egIs1 [dat-1p::GFP]. otIs860 [flp-33p::tagRFP]. CEP neurons are marked with bright green expression (dat-1p::GFP), and can be sorted by selecting the brightest GFP. there are other cells in which the GFP marker shows up, but expression is faint. Other fluorescing neurons (ADE and PDE) will be double positive (GFP and tagRFP). Used by CeNGEN project for RNA-Seq (https:|"Made_by: Hobert Lab" | WB-STRAIN:WBStrain00055025 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:48 | 0 | ||||||
|
otIs854. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055024 | Caenorhabditis elegans | otIs854. | Made_by: Cyril Cros|"otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:" | WB-STRAIN:WBStrain00055024 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||||
|
san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054972 | Caenorhabditis elegans | san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I. | GFP tag inserted at 5' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac | WBGene00004721(san-1) | WBGene00004721(san-1) | WB-STRAIN:WBStrain00054972 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
otIs867. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055027 | Caenorhabditis elegans | otIs867. | Made_by: Cyril Cros|"otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:" | WB-STRAIN:WBStrain00055027 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||||
|
npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055023 | Caenorhabditis elegans | npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. | CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"|"Made_by: Suny Biotech" | WBGene00001864(him-5)|WBGene00019774(npr-37) | WBGene00001864(him-5), WBGene00019774(npr-37) | WB-STRAIN:WBStrain00055023 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:47 | 0 | ||||
|
knl-1(lt75[knl-1::mCherry]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054973 | Caenorhabditis elegans | knl-1(lt75[knl-1::mCherry]) III. | Made_by: Arshad Desai lab|"mCherry tag inserted at N-terminus of endogenous knl-1 locus using by CRISPR/Cas9 engineering. Reference: Cheerambathur DK, et al. Dev Cell. 2019 Mar 25;48(6):864-872.e7. doi: 10.1016/j.devcel.2019.02.002. PMID: 30827898" | WBGene00002231(knl-1) | WBGene00002231(knl-1) | WB-STRAIN:WBStrain00054973 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 | ||||
|
cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00054976 | Caenorhabditis elegans | cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. | mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029. | WBGene00000868(cyb-3) | WBGene00000868(cyb-3) | WB-STRAIN:WBStrain00054976 | WormBase (WB) | WB | unknown | 2026-08-29 09:28:46 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
