Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00054999
Source Database: WormBase (WB)
Affected Genes: WBGene00006778(unc-42)
Genomic Alteration: WBGene00006778(unc-42)
Availability: unknown
Source References: EMPTY
Synonyms: unc-42(ot986[unc-42::gfp]) V.
Notes: GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903.doi: 10.7554/eLife.64903. PMID: 34165428|"Made_by: Suny Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00054999 Copy
http://www.wormbase.org/db/get?name=WBStrain00054998
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs742.
Notes: Made_by: Berta Vidal (Hobert Lab)|"otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"|"otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00054998 Copy
http://www.wormbase.org/db/get?name=WBStrain00054997
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs711.
Notes: Made_by: Berta Vidal (Hobert Lab)|"otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"|"otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00054997 Copy
http://www.wormbase.org/db/get?name=WBStrain00054981
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: ltSi220 I; ltSi1232 II; unc-119(ed3) III.
Notes: ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
Proper citation: RRID:WB-STRAIN:WBStrain00054981 Copy
http://www.wormbase.org/db/get?name=WBStrain00055035
Source Database: WormBase (WB)
Affected Genes: WBGene00005016(sqt-1)|WBGene00006537(tbb-2)|WBGene00219714(linc-3)
Genomic Alteration: WBGene00005016(sqt-1), WBGene00006537(tbb-2), WBGene00219714(linc-3)
Availability: unknown
Source References: EMPTY
Synonyms: linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V.
Notes: Made_by: Sandeep Wontakal|"The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers."
Proper citation: RRID:WB-STRAIN:WBStrain00055035 Copy
http://www.wormbase.org/db/get?name=WBStrain00054983
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: ltSi220 I; ltSi1561 II; unc-119(ed3) III.
Notes: ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
Proper citation: RRID:WB-STRAIN:WBStrain00054983 Copy
http://www.wormbase.org/db/get?name=WBStrain00055032
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00002113(ins-30)
Genomic Alteration: WBGene00001864(him-5), WBGene00002113(ins-30)
Availability: unknown
Source References: EMPTY
Synonyms: ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V.
Notes: CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:"|"Made_by: Suny Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055032 Copy
http://www.wormbase.org/db/get?name=WBStrain00055031
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00002107(ins-24)
Genomic Alteration: WBGene00001864(him-5), WBGene00002107(ins-24)
Availability: unknown
Source References: EMPTY
Synonyms: ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V.
Notes: CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https:"|"Made_by: Suny Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055031 Copy
http://www.wormbase.org/db/get?name=WBStrain00055034
Source Database: WormBase (WB)
Affected Genes: WBGene00005016(sqt-1)|WBGene00006537(tbb-2)|WBGene00010424(lep-5)
Genomic Alteration: WBGene00005016(sqt-1), WBGene00006537(tbb-2), WBGene00010424(lep-5)
Availability: unknown
Source References: EMPTY
Synonyms: lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X.
Notes: Made_by: Sandeep Wontakal|"The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails."
Proper citation: RRID:WB-STRAIN:WBStrain00055034 Copy
http://www.wormbase.org/db/get?name=WBStrain00054989
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs601.
Notes: otIs601[ceh-19p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for MC pharyngeal neurons. Please contact Oliver Hobert prior to publishing work using this strain.
Proper citation: RRID:WB-STRAIN:WBStrain00054989 Copy
http://www.wormbase.org/db/get?name=WBStrain00054988
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs597.
Notes: otIs597 [ser-7p::eGFP::rab-3 + ttx-3::mCherry]. Presynaptic marker for M4 pharyngeal neuron. Please contact Oliver Hobert prior to publishing work using this strain.
Proper citation: RRID:WB-STRAIN:WBStrain00054988 Copy
http://www.wormbase.org/db/get?name=WBStrain00054984
Source Database: WormBase (WB)
Affected Genes: WBGene00002068(ify-1)
Genomic Alteration: WBGene00002068(ify-1)
Availability: unknown
Source References: EMPTY
Synonyms: ify-1(lt212[mNG::ify-1]) II.
Notes: mNeonGreen tag inserted at 5' end of endogenous ify-1 locus using CRISPR/Cas9 engineering. gRNA sequence: catactcgcacaagtcaaaA
Proper citation: RRID:WB-STRAIN:WBStrain00054984 Copy
http://www.wormbase.org/db/get?name=WBStrain00054987
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: ltSi264 II; unc-119(ed3) III.
Notes: ltSi264 [bub-1p::bub-1(re-encoded)::RFP + Cbr-unc-119(+)] II. BUB-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Pelisch F, et al. Mol Cell. 2017 Jan 5;65(1):66-77. doi: 10.1016/j.molcel.2016.11.001. PMID: 27939944|"Made_by: Arshad Desai lab"
Proper citation: RRID:WB-STRAIN:WBStrain00054987 Copy
http://www.wormbase.org/db/get?name=WBStrain00055025
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: egIs1; otIs860.
Notes: egIs1 [dat-1p::GFP]. otIs860 [flp-33p::tagRFP]. CEP neurons are marked with bright green expression (dat-1p::GFP), and can be sorted by selecting the brightest GFP. there are other cells in which the GFP marker shows up, but expression is faint. Other fluorescing neurons (ADE and PDE) will be double positive (GFP and tagRFP). Used by CeNGEN project for RNA-Seq (https:|"Made_by: Hobert Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00055025 Copy
http://www.wormbase.org/db/get?name=WBStrain00055024
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs854.
Notes: Made_by: Cyril Cros|"otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055024 Copy
http://www.wormbase.org/db/get?name=WBStrain00054972
Source Database: WormBase (WB)
Affected Genes: WBGene00004721(san-1)
Genomic Alteration: WBGene00004721(san-1)
Availability: unknown
Source References: EMPTY
Synonyms: san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I.
Notes: GFP tag inserted at 5' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac
Proper citation: RRID:WB-STRAIN:WBStrain00054972 Copy
http://www.wormbase.org/db/get?name=WBStrain00055027
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: otIs867.
Notes: Made_by: Cyril Cros|"otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00055027 Copy
http://www.wormbase.org/db/get?name=WBStrain00055023
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00019774(npr-37)
Genomic Alteration: WBGene00001864(him-5), WBGene00019774(npr-37)
Availability: unknown
Source References: EMPTY
Synonyms: npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V.
Notes: CRISPR/Cas9 engineered tagged endogenous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:|"CRISPR/Cas9 engineered tagged endogneous locus. Him. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:"|"Made_by: Suny Biotech"
Proper citation: RRID:WB-STRAIN:WBStrain00055023 Copy
http://www.wormbase.org/db/get?name=WBStrain00054973
Source Database: WormBase (WB)
Affected Genes: WBGene00002231(knl-1)
Genomic Alteration: WBGene00002231(knl-1)
Availability: unknown
Source References: EMPTY
Synonyms: knl-1(lt75[knl-1::mCherry]) III.
Notes: Made_by: Arshad Desai lab|"mCherry tag inserted at N-terminus of endogenous knl-1 locus using by CRISPR/Cas9 engineering. Reference: Cheerambathur DK, et al. Dev Cell. 2019 Mar 25;48(6):864-872.e7. doi: 10.1016/j.devcel.2019.02.002. PMID: 30827898"
Proper citation: RRID:WB-STRAIN:WBStrain00054973 Copy
http://www.wormbase.org/db/get?name=WBStrain00054976
Source Database: WormBase (WB)
Affected Genes: WBGene00000868(cyb-3)
Genomic Alteration: WBGene00000868(cyb-3)
Availability: unknown
Source References: EMPTY
Synonyms: cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V.
Notes: mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
Proper citation: RRID:WB-STRAIN:WBStrain00054976 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.