Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC1578 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036704 | Caenorhabditis elegans | Y38H8A.4&Y38H8A.3(gk727) IV. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1192 bp. Deletion left flank: TTGATCACCTTCGCCGCCACTTCAAGCTTC. Deletion right flank: TTGTACAGGCCTATTTCTCAGATTAAGCCT. Insertion Sequence: GAAA." | WBGene00012637(ttbk-8.1)|WBGene00012638(Y38H8A.4) | WBGene00012637(ttbk-8.1), WBGene00012638(Y38H8A.4) | WB-STRAIN:WBStrain00036704 | WormBase (WB) | WB | available | WB-STRAIN:VC1578, CGC_VC1578 | 2026-08-29 09:23:07 | 0 | |||
|
VC1581 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036707 | Caenorhabditis elegans | mksr-1(gk739) X. | K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 1241 bp. Deletion left flank: AATCGACTTTTTGGAGTTTTTTGGCAAATA. Deletion right flank: TACATCAAAAAAAATACTGTGATAAAAATT. Insertion Sequence: A.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019364(mksr-1) | WBGene00019364(mksr-1) | WB-STRAIN:WBStrain00036707 | WormBase (WB) | WB | available | WB-STRAIN:VC1581, CGC_VC1581 | 2026-08-29 09:23:07 | 0 | |||
|
VC1583 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036709 | Caenorhabditis elegans | cdh-1(gk747) III. | Mutagen:UV/TMP|"R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC."|"R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019994(cdh-1) | WBGene00019994(cdh-1) | WB-STRAIN:WBStrain00036709 | WormBase (WB) | WB | available | WB-STRAIN:VC1583, CGC_VC1583 | 2026-08-29 09:23:07 | 0 | |||
|
VC1680 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036785 | Caenorhabditis elegans | +/szT1 [lon-2(e678)] I; ham-2(gk780)/szT1 X. | C07A12.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk780 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGATTATGGGGTCGAATGG. External right primer: TGGAAAGATGGGGCAATTAG. Internal left primer: GGGAGCGAGAGAGAGACAAA. Internal right primer: GCTCCAGTGGGAAATTGAAA. Internal WT amplicon: 2317 bp. Deletion size: 1294 bp. Deletion left flank: AATGCATTGTCCAATCGCTGCTATGTATGC. Deletion right flank: AGAGCCAAAATGACCAACATTATTGACAGT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001821(ham-2)|WBGene00003056(lon-2) | WBGene00001821(ham-2), WBGene00003056(lon-2) | WB-STRAIN:WBStrain00036785 | WormBase (WB) | WB | available | WB-STRAIN:VC1680, CGC_VC1680 | 2026-08-29 09:23:09 | 0 | |||
|
VC1679 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036784 | Caenorhabditis elegans | efl-1(gk790) V/nT1 [qIs51] (IV;V). | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y102A5C.18. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk790 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. NOTE: Balancer is prone to breaking down. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: TGTCGTTTCCCTTCCTTCAC. External right primer: TAGGCACAGCTTGAACCCTT. Internal left primer: TGGAGCGAAATTGAGGCTAT. Internal right primer: CAGAAAGCTAAGACCTGCGG. Internal WT amplicon: 1986 bp. Deletion size: 671 bp. Deletion left flank: GTGTCAAAAATGAAATTTTCATATGAAAAT. Deletion right flank: CAAAGTCAAGCTCATTGTCGAGCCCGAGCA." | WBGene00001161(efl-1) | WBGene00001161(efl-1) | WB-STRAIN:WBStrain00036784 | WormBase (WB) | WB | available | WB-STRAIN:VC1679, CGC_VC1679 | 2026-08-29 09:23:09 | 0 | |||
|
VC1682 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036787 | Caenorhabditis elegans | T10B10.3(ok2184) X. | T10B10.3. External left primer: TATGGGGAAAATTGGGACAA. External right primer: TAGACATTTGGGCAATGCAA. Internal left primer: ATCATCATCAAGCTTTGCCC. Internal right primer: ACCGCACAACATATGACGAA. Internal WT amplicon: 2804 bp. Deletion size: 2484 bp. Deletion left flank: AAGCCGTTCCAGCTCCTTATCGAATCGGAC. Deletion right flank: TCACTTTGTTTACATATCCTTCGACCAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011680(pkhm-2) | WBGene00011680(pkhm-2) | WB-STRAIN:WBStrain00036787 | WormBase (WB) | WB | available | PMID:36652947 | WB-STRAIN:VC1682, CGC_VC1682 | 2026-08-29 09:23:09 | 0 | ||
|
VC1687 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036790 | Caenorhabditis elegans | unc-39(gk798) V/nT1 [qIs51] (IV;V). | F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk798 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1032 bp. Deletion left flank: CGAGGGAAATCAAATATCAGAACTTGAAAA. Deletion right flank: TATCATTCCAATGAATTCGAGACACTCTTC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006775(unc-39) | WBGene00006775(unc-39) | WB-STRAIN:WBStrain00036790 | WormBase (WB) | WB | available | WB-STRAIN:VC1687, CGC_VC1687 | 2026-08-29 09:23:09 | 0 | |||
|
VC1688 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036791 | Caenorhabditis elegans | sex-1(gk808) X. | F44A6.2. External left primer: ACCATTCATGCCTACCTTGC. External right primer: GTCATCGCTTCCCAACATCT. Internal left primer: ATCCACTTGCTTTGTCTCCG. Internal right primer: TGGTGAAGTGAGCTCGAGTG. Internal WT amplicon: 2458 bp. Deletion size: 630 bp. Deletion left flank: AACTCAACTTGGCAGATTACAGATTTAACA. Deletion right flank: TCTTAGGTGAGGAAAAAAATCTGTGTTGCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004786(sex-1) | WBGene00004786(sex-1) | WB-STRAIN:WBStrain00036791 | WormBase (WB) | WB | available | WB-STRAIN:VC1688, CGC_VC1688 | 2026-08-29 09:23:09 | 0 | |||
|
VC1638 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036758 | Caenorhabditis elegans | ZK1025.4(ok2101) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK1025.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2101 homozygotes (sterile, lays unfertilized eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGCTGTTCGGGAAAAAT. External right primer: CAACTTTCCGGCTTGTAGGA. Internal left primer: TTTCCGGGTGAGTGAGTTTC. Internal right primer: GCGTCCGTGAAATTTGAGAT. Internal WT amplicon: 3284 bp. Deletion size: 1617 bp. Deletion left flank: TAAGCTTGGCGTCAGAGGCGAGCGTTAGCT. Deletion right flank: TTTCCGCCAGATCGGCAAATTTGCCGGAAT." | WBGene00000254(bli-4)|WBGene00014184(gtnt-53) | WBGene00000254(bli-4), WBGene00014184(gtnt-53) | WB-STRAIN:WBStrain00036758 | WormBase (WB) | WB | available | WB-STRAIN:VC1638, CGC_VC1638 | 2026-08-29 09:23:09 | 0 | |||
|
VC1640 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036759 | Caenorhabditis elegans | dcap-1&Y55F3AM.13(ok2139) IV. | Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y55F3AM.13, Y55F3AM.12. External left primer: AAATCAGGGAAATATCGGGG. External right primer: TTTTCCAGGGTAAATCACGC. Internal left primer: GTCGTCGGTTTGCATTAGGT. Internal right primer: ACGTGGGAGACCAATCTGAC. Internal WT amplicon: 2730 bp. Deletion size: 1252 bp. Deletion left flank: AGCTTCTGGAGCATTGGCGGCATTTGTTCG. Deletion right flank: TTCCTACTTTTCCCAGCCAAATCGCTTGAT." | WBGene00021929(dcap-1)|WBGene00021930(Y55F3AM.13) | WBGene00021929(dcap-1), WBGene00021930(Y55F3AM.13) | WB-STRAIN:WBStrain00036759 | WormBase (WB) | WB | available | WB-STRAIN:VC1640, CGC_VC1640 | 2026-08-29 09:23:10 | 0 | |||
|
VC1630 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036750 | Caenorhabditis elegans | Y54E5A.2(ok2070)/hIn1 [unc-101(sy241)] I. | Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y54E5A.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTTTCGGTGTTGAGAGCGT. External right primer: TGGTGCATGATTTGTGGATT. Internal left primer: GCTCACAACTTCACGCAGAG. Internal right primer: TAAACACCAAGTGGCACCAA. Internal WT amplicon: 2168 bp. Deletion size: 1739 bp. Deletion left flank: AATTTCACGGGGTATATTTAATTTTTAATT. Deletion right flank: TTTTATCATGATATCTCAAAAGTTGAGTGC." | WBGene00006829(unc-101)|WBGene00013198(Y54E5A.2) | WBGene00006829(unc-101), WBGene00013198(Y54E5A.2) | WB-STRAIN:WBStrain00036750 | WormBase (WB) | WB | available | WB-STRAIN:VC1630, CGC_VC1630 | 2026-08-29 09:23:09 | 0 | |||
|
VC1631 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036751 | Caenorhabditis elegans | dyf-3(gk760) IV/nT1 [qIs51] (IV;V). | C04C3.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk760 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACCCATCATGTTACCGT. External right primer: GAAGCTCGTCGACCGTAGTC. Internal left primer: TCACGCATCCTTCTTCTCCT. Internal right primer: TTGCAGGGAGTTTCTATGGG. Internal WT amplicon: 1853 bp. Deletion size: 736 bp. Deletion left flank: TACTCGTCCATATACTGAGGTCGGAAGGAC. Deletion right flank: CGGACCTCCTGCATCTGAACTTTCGACAGT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001119(dyf-3) | WBGene00001119(dyf-3) | WB-STRAIN:WBStrain00036751 | WormBase (WB) | WB | available | WB-STRAIN:VC1631, CGC_VC1631 | 2026-08-29 09:23:08 | 0 | |||
|
VC1633 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036753 | Caenorhabditis elegans | unc-120(gk719) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00006844(unc-120) | WBGene00000254(bli-4), WBGene00006844(unc-120) | WB-STRAIN:WBStrain00036753 | WormBase (WB) | WB | available | WB-STRAIN:VC1633, CGC_VC1633 | 2026-08-29 09:23:09 | 0 | |||
|
VC1636 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036756 | Caenorhabditis elegans | rsp-7&D2089.2(ok2079)/mIn1 [mIs14 dpy-10(e128)] II. | D2089.1, D2089.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2079 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAATTACGTCGCCGGTTTA. External right primer: CACTGTTTTTCGGAGCCAAT. Internal left primer: ACATTTCGACATCGGCTACC. Internal right primer: CACCTCAACTTATTCGGGGA. Internal WT amplicon: 3201 bp. Deletion size: 1429 bp. Deletion left flank: TAAGCCATTTCTCGAAGAAAACAAAGCACA. Deletion right flank: AGATCCAAAGATCGAAAGCGTGACAAGAAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001072(dpy-10)|WBGene00004704(rsp-7)|WBGene00008433(marc-2) | WBGene00001072(dpy-10), WBGene00004704(rsp-7), WBGene00008433(marc-2) | WB-STRAIN:WBStrain00036756 | WormBase (WB) | WB | available | WB-STRAIN:VC1636, CGC_VC1636 | 2026-08-29 09:23:09 | 0 | |||
|
VC1654 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036769 | Caenorhabditis elegans | nhr-259(gk792) I. | C27C7.8. External left primer: TCCAAAATTCTCGTTCGGAG. External right primer: TCGACTTACCTCTGACCGCT. Internal left primer: TTCGGAATTTCTGTCCGAAG. Internal right primer: GTCGATGCACCAATGTTGAC. Internal WT amplicon: 2373 bp. Deletion size: 1439 bp. Deletion left flank: AAAAGGTTGGTAGTCGTCGGGAAATATATA. Deletion right flank: CCCACGAACCCACAATCACCATCCGCATGA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007770(nhr-259) | WBGene00007770(nhr-259) | WB-STRAIN:WBStrain00036769 | WormBase (WB) | WB | available | WB-STRAIN:VC1654, CGC_VC1654 | 2026-08-29 09:23:08 | 0 | |||
|
VC1698 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036801 | Caenorhabditis elegans | nhr-118(gk3041) V. | Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3041) in F13A2.8, detectable by PCR using the following primers. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1081 bp. Deletion left flank: AGCCAGGTTTGCTCAAGGTAAAAAATGCCT. Deletion right flank: TTTTACTCCTTTTTCTACAGTCGTTGTTAT. Validation: gk3041 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003708(nhr-118) | WBGene00003708(nhr-118) | WB-STRAIN:WBStrain00036801 | WormBase (WB) | WB | available | WB-STRAIN:VC1698, CGC_VC1698 | 2026-08-29 09:23:10 | 0 | |||
|
VC1642 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036761 | Caenorhabditis elegans | dnj-11(gk1025) IV. | F38A5.13. External left primer: ATCCAACTCGGCATCATCTC. External right primer: AATGCAAATCCGCTCAATTC. Internal left primer: TGAAGTCGAATCTGCGAGTG. Internal right primer: GCGAGTTTCTTCAGACGCTT. Internal WT amplicon: 2118 bp. Deletion size: 563 bp. Deletion left flank: ATGGTCCAATATCAAGCCAGTGCCAGAACT. Deletion right flank: GCGTAAGCGTCTGAAGAAACTCGCTGATGA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001029(dnj-11) | WBGene00001029(dnj-11) | WB-STRAIN:WBStrain00036761 | WormBase (WB) | WB | available | WB-STRAIN:VC1642, CGC_VC1642 | 2026-08-29 09:23:09 | 0 | |||
|
VC1641 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036760 | Caenorhabditis elegans | daf-10(gk795) IV. | F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000906(daf-10) | WBGene00000906(daf-10) | WB-STRAIN:WBStrain00036760 | WormBase (WB) | WB | available | WB-STRAIN:VC1641, CGC_VC1641 | 2026-08-29 09:23:08 | 0 | |||
|
VC1697 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00036800 | Caenorhabditis elegans | mltn-13(gk807) X. | F15A8.7. External left primer: TTGGGCCTGAGACCTTATTG. External right primer: CCCCCTCAAACTCAAGCATA. Internal left primer: AGCCTGATCCGATTTCAATG. Internal right primer: TCAACTGTGGTCATTTCGGA. Internal WT amplicon: 2295 bp. Deletion size: 960 bp. Deletion left flank: AAAAAATATTCCATTCGAAAGTAATTCGTA. Deletion right flank: ACTCTGAAAAATACATTTACTTAACATTCA. Insertion Sequence: ATA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017794(mltn-13) | WBGene00017794(mltn-13) | WB-STRAIN:WBStrain00036800 | WormBase (WB) | WB | available | PMID:38177158 | WB-STRAIN:VC1697, CGC_VC1697 | 2026-08-29 09:23:10 | 1 | ||
|
VC1647 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00036766 | Caenorhabditis elegans | unc-39(gk765) V. | F56A12.1. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1130 bp. Deletion left flank: AGGTGCCTCCCCCTCTTGGACTGTTGTACC. Deletion right flank: TTCCGCAAGTATCTGATATAGAACTTTACA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006775(unc-39) | WBGene00006775(unc-39) | WB-STRAIN:WBStrain00036766 | WormBase (WB) | WB | available | WB-STRAIN:VC1647, CGC_VC1647 | 2026-08-29 09:23:08 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
