Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12902616
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-05-09)
Alternate IDs: 12902616
Notes: These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE gene Horizon Discovery
Proper citation: RRID:RGD_12902616 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207513
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2017-08-03)
Alternate IDs: 13207513
Notes: This is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207513 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208842
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13208842
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13208842 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13437612
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13437612
Notes: This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.
Proper citation: RRID:RGD_13437612 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207595
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207595
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207595 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207518
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2018-05-01)
Alternate IDs: 13207518
Notes: CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207518 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207514
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-08-03)
Alternate IDs: 13207514
Notes: CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207514 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12910940
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 12910940
Notes: The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype.
Proper citation: RRID:RGD_12910940 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207494
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207494
Notes: CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13207494 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904893
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2017-05-24)
Alternate IDs: 12904893
Notes: This ZFN model carries the knockout of the rat Slc22a8. Horizon Discovery
Proper citation: RRID:RGD_12904893 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13204788
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13204788
Notes: CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_13204788 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13782371
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13782371
Notes: A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains.
Proper citation: RRID:RGD_13782371 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904684
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-05-17)
Alternate IDs: 12904684
Notes: This model contains two knockout genes, the 20-bp deletion within rat Abcba1 and the 588-bp deletion within rat Abcg2 gene. Horizon Discovery
Proper citation: RRID:RGD_12904684 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904685
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-05-17)
Alternate IDs: 12904685
Notes: This ZFN model contains a biallelic 726 bp deletion within the Abcc2 gene. Animals exhibit decreased transport of endogenous glutathione and hyperbilirubinemia. The homozygous knockout rats display total loss of protein via Western blot. Horizon Discovery
Proper citation: RRID:RGD_12904685 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12880037
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 12880037
Notes: This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation.
Proper citation: RRID:RGD_12880037 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12880021
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-05-01)
Alternate IDs: 12880021
Notes: The mutant rat strain was produced by injecting zinc endonuclease targeting the exon 3 of rat Apoe into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in the gene and resulted in complete loss of Apoe protein in homozygotes. Horizon Discovery
Proper citation: RRID:RGD_12880021 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904679
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 12904679
Notes: ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation.
Proper citation: RRID:RGD_12904679 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800556
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 13800556
Notes: The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG.
Proper citation: RRID:RGD_13800556 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12910505
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 12910505
Notes: TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon
Proper citation: RRID:RGD_12910505 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12904063
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals (as of 2017-05-16)
Alternate IDs: 12904063
Notes: This ZFN model carries a 588-bp deletion within Abcg2 gene. Homozygous knockouts display total loss of protein via Western blot Horizon Discovery
Proper citation: RRID:RGD_12904063 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.