Plasmids   Select Another Resource Report Type

http://www.addgene.org/115924

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter.

Proper citation: RRID:Addgene_115924 Copy   

•   Source: Addgene
  

http://www.addgene.org/115926

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression

Proper citation: RRID:Addgene_115926 Copy   

•   Source: Addgene
  

http://www.addgene.org/188474

Genetic Insert: P-R-lox-TT-lox-bla
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188474 Copy   

•   Source: Addgene
  

http://www.addgene.org/188475

Genetic Insert: P-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188475 Copy   

•   Source: Addgene
  

http://www.addgene.org/188476

Genetic Insert: P*-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188476 Copy   

•   Source: Addgene
  

http://www.addgene.org/172602

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:34369028
Comments: The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/.  The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)].  The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site.  The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay.

Proper citation: RRID:Addgene_172602 Copy   

•   Source: Addgene
  

http://www.addgene.org/191530

Species: E.coli
Genetic Insert: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:34949838
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)

Proper citation: RRID:Addgene_191530 Copy   

•   Source: Addgene
  

http://www.addgene.org/132780

Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33536221
Comments: Genotype: W3110 ∆waaL ∆lpxM

Proper citation: RRID:Addgene_132780 Copy   

•   Source: Addgene
  

http://www.addgene.org/197934

Genetic Insert: RNA polymerase gene (T7 phage)/chromosome
Vector Backbone Description: Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:25982672
Comments: Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR.

Proper citation: RRID:Addgene_197934 Copy   

•   Source: Addgene
  

http://www.addgene.org/69778

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69778 Copy   

•   Source: Addgene
  

http://www.addgene.org/69775

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69775 Copy   

•   Source: Addgene
  

http://www.addgene.org/69774

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69774 Copy   

•   Source: Addgene
  

http://www.addgene.org/69782

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69782 Copy   

•   Source: Addgene
  

http://www.addgene.org/69781

Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:27084942

Proper citation: RRID:Addgene_69781 Copy   

•   Source: Addgene
  

http://www.addgene.org/78552

Genetic Insert: pTet--Cas9 cassette integrated at 186 primary attB site
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:27060147

Proper citation: RRID:Addgene_78552 Copy   

•   Source: Addgene
  

http://www.addgene.org/72402

Vector Backbone Description: Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:26315440
Comments: No antibiotic resistance.

Proper citation: RRID:Addgene_72402 Copy   

•   Source: Addgene
  

http://www.addgene.org/61917

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61917 Copy   

•   Source: Addgene
  

http://www.addgene.org/61918

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA Precursor strain = ML26 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61918 Copy   

•   Source: Addgene
  

http://www.addgene.org/61914

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = tyrA hisG Precursor strain = ML14 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Tyr), His Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61914 Copy   

•   Source: Addgene
  

http://www.addgene.org/61922

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA lysA thrC asnA asnB Precursor strain = ML42 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met, Lys, Thr, Asn *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61922 Copy   

•   Source: Addgene