Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAC1410-pmax-dCas9Master_p65HSF1 Resource Report Resource Website |
RRID:Addgene_71907 | dCas9-p65HSF1 | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:47 | 0 | |
|
pAC1411-pmax-NLSPUFc_p65HSF1 Resource Report Resource Website |
RRID:Addgene_71908 | PUFc-p65HSF1 | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:47 | 0 | |
|
pAC1355-pmax-NLSPUFa_VP64 Resource Report Resource Website |
RRID:Addgene_71881 | NLSPUFa_VP64 | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:46 | 0 | |
|
pAC1364-pmax-dCas9Master_mCBPHAT Resource Report Resource Website |
RRID:Addgene_71887 | dCas9-mCBPHAT | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:46 | 0 | |
|
pAC164-pmax-dCas9Master-VP64 Resource Report Resource Website |
RRID:Addgene_71879 | dCas9-VP64 | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates, and protocols. For more information on Cheng Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/albert-cheng/ | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:46 | 0 | |
|
pAC1445-pmax-dCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_73169 | dCas9 | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates and protocols | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-29 01:10:00 | 2 | |
|
pAC1447_pmax-Clover_PUFc Resource Report Resource Website 1+ mentions |
RRID:Addgene_73689 | Clover_PUFc | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates and protocols | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:10:05 | 3 | |
|
pAC1446_pmax-Clover_PUFa Resource Report Resource Website |
RRID:Addgene_73688 | Clover_PUFa | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates and protocols | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:10:05 | 0 | |
|
pAC1448_pmax-mRuby2_PUFa Resource Report Resource Website 1+ mentions |
RRID:Addgene_73690 | mRuby2_PUFa | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates and protocols | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:10:05 | 1 | |
|
pAC1392_pmax-PUFb_p65HSF1 Resource Report Resource Website |
RRID:Addgene_73697 | PUFb_p65HSF1 | Synthetic | Kanamycin | PMID:26768771 | Please visit http://casil.io for more information, updates and protocols | Vector Backbone:pAC90-pmax-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:10:05 | 0 | |
|
DVK_EF Resource Report Resource Website |
RRID:Addgene_66069 | None | Synthetic | Kanamycin | PMID:26479688 | parts.igem.org/Part:pSB1K3 | Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:56 | 0 | |
|
DVK_AE Resource Report Resource Website |
RRID:Addgene_66067 | None | Synthetic | Kanamycin | PMID:26479688 | parts.igem.org/Part:pSB1K3 | Vector Backbone:DVK; Vector Types:Synthetic Biology, Other, Destination Vector; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:01 | 0 | |
|
DVK_GH Resource Report Resource Website |
RRID:Addgene_66071 | None | Synthetic | Kanamycin | PMID:26479688 | parts.igem.org/Part:pSB1K3 | Vector Backbone:DVK; Vector Types:Gateway Cloning, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:56 | 0 | |
|
SupD Resource Report Resource Website |
RRID:Addgene_68307 | 2xtRNA-SupD | Kanamycin | PMID:26350500 | See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression. | Vector Backbone:pKD; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 01:09:15 | 0 | ||
|
mRFP1-Zyxin-6 Resource Report Resource Website |
RRID:Addgene_55925 | Zyxin | Homo sapiens | Kanamycin | . Excitation = 584; Emission = 607 | Backbone Size:4750; Vector Backbone:mRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:07:26 | 0 | ||
|
rsEGFP2-H2B-6 Resource Report Resource Website |
RRID:Addgene_56533 | H2B | Homo sapiens | Kanamycin | Backbone Size:4750; Vector Backbone:rsEGFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | D26G and V119I in H2B | 2026-08-29 01:07:31 | 0 | ||
|
mTagRFP-T-Vimentin-7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_58029 | NM_003380.3 | Homo sapiens | Kanamycin | PMID:18454154 | . Excitation = 555; Emission = 584 | Backbone Size:4750; Vector Backbone:mTagRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:07:48 | 2 | |
|
DV2 VLPs pVRC8400 Resource Report Resource Website |
RRID:Addgene_63161 | DV2 prM-E | Kanamycin | PMID:29999491 | Please visit https://www.biorxiv.org/content/early/2018/03/22/286955 for bioRxiv preprint. | Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:30 | 0 | ||
|
mApple-Desmoglein1-C-18 Resource Report Resource Website |
RRID:Addgene_54887 | Desmoglein1 | Homo sapiens | Kanamycin | . Excitation = 568; Emission = 592 | Backbone Size:4750; Vector Backbone:mApple-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:07:13 | 0 | ||
|
pCoofy49 Resource Report Resource Website |
RRID:Addgene_55187 | Kanamycin | PMID:23410102 | C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. | Backbone Marker:Novagen; Backbone Size:7701; Vector Backbone:pET, pCoofy4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:07:17 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.