Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 97 showing 1921 ~ 1940 out of 30,615 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_51694

    This resource has 1+ mentions.

http://www.addgene.org/51694

Species: Synthetic
Genetic Insert: Optopatch2
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910

Proper citation: RRID:Addgene_51694 Copy   


  • RRID:Addgene_51695

    This resource has 1+ mentions.

http://www.addgene.org/51695

Species: Synthetic
Genetic Insert: Optopatch1
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9236; Vector Backbone:FCK(1.3); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952910

Proper citation: RRID:Addgene_51695 Copy   


  • RRID:Addgene_51638

    This resource has 1+ mentions.

http://www.addgene.org/51638

Species: Synthetic
Genetic Insert: Codon-optimized Cas9 D10A
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24491566
Comments: This plasmid vector was constructed by mutation PCR of pCAG-T3-hCAS9-pA plasmid vector (Addgene plasmid 48625) using the primers (Forward primer, 5’-AGTACTCCATTGGGCTCGccATCGGCACAAAC, and Reverse primer, 5’-CGAGCCCAATGGAGTACTTCTTGTCGGCTGC). For the in vitro synthesis of CAS9 D10A mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA. The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment. The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.

Proper citation: RRID:Addgene_51638 Copy   


  • RRID:Addgene_51790

http://www.addgene.org/51790

Species: Synthetic
Genetic Insert: EBFP2
Vector Backbone Description: Vector Backbone:pZDONOR 5-6; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25369267

Proper citation: RRID:Addgene_51790 Copy   


  • RRID:Addgene_46759

    This resource has 50+ mentions.

http://www.addgene.org/46759

Species: Synthetic
Genetic Insert: gRNA core
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pUC19; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/

Proper citation: RRID:Addgene_46759 Copy   


  • RRID:Addgene_46757

    This resource has 100+ mentions.

http://www.addgene.org/46757

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2800; Vector Backbone:pT3T7; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/

Proper citation: RRID:Addgene_46757 Copy   


  • RRID:Addgene_46966

    This resource has 10+ mentions.

http://www.addgene.org/46966

Species: Synthetic
Genetic Insert: AtU6p::sgRNA_PDS
Vector Backbone Description: Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23929340
Comments: gRNA target sequence GCCGTTAATTTGAGAGTCCA

Proper citation: RRID:Addgene_46966 Copy   


  • RRID:Addgene_46956

    This resource has 1+ mentions.

http://www.addgene.org/46956

Species: Synthetic
Genetic Insert: FLAG tag
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46956 Copy   


http://www.addgene.org/47549

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23995389
Comments: For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/ Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3

Proper citation: RRID:Addgene_47549 Copy   


  • RRID:Addgene_47540

    This resource has 1+ mentions.

http://www.addgene.org/47540

Species: Synthetic
Genetic Insert: SOX2 shRNA
Vector Backbone Description: Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22941189

Proper citation: RRID:Addgene_47540 Copy   


  • RRID:Addgene_47512

http://www.addgene.org/47512

Species: Synthetic
Genetic Insert: gRNA-EGFP site 2
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23792628
Comments: Target site: GATGCCGTTCTTCTGCTTGT gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)

Proper citation: RRID:Addgene_47512 Copy   


http://www.addgene.org/47456

Species: Synthetic
Genetic Insert: TALE(Grm2)-GS-CIB1(NLS*,∆318-334)
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069

Proper citation: RRID:Addgene_47456 Copy   


http://www.addgene.org/47455

Species: Synthetic
Genetic Insert: NLS(alpha-imp)-CRY2PHR-NLS-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069

Proper citation: RRID:Addgene_47455 Copy   


http://www.addgene.org/47446

Species: Synthetic
Genetic Insert: TALE BB(N136_0.5HD_C63)-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069

Proper citation: RRID:Addgene_47446 Copy   


http://www.addgene.org/47449

Species: Synthetic
Genetic Insert: TALE BB(N136_0.5NN_C63)-SID4X
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069

Proper citation: RRID:Addgene_47449 Copy   


http://www.addgene.org/47448

Species: Synthetic
Genetic Insert: TALE BB(N136_0.5NI_C63)-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069

Proper citation: RRID:Addgene_47448 Copy   


  • RRID:Addgene_47441

    This resource has 1+ mentions.

http://www.addgene.org/47441

Species: Synthetic
Genetic Insert: Gene Expression Reporter Construct
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:2628; Vector Backbone:pJ251; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_47441 Copy   


  • RRID:Addgene_47442

http://www.addgene.org/47442

Species: Synthetic
Genetic Insert: mcpGFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM T-easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Comments: same as Tian L, Hires SA, Mao T, Huber D, Chiappe ME, Chalasani SH, et al. 2009. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat Methods 6:875–81. doi: 10.1038/nmeth.1398.

Proper citation: RRID:Addgene_47442 Copy   


http://www.addgene.org/47550

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23995389
Comments: For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/ gRNA target sequence atatcagtctgtttcgtaa Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3

Proper citation: RRID:Addgene_47550 Copy   


  • RRID:Addgene_47709

    This resource has 1+ mentions.

http://www.addgene.org/47709

Species: Synthetic
Genetic Insert: Codon-optimised MSP1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421

Proper citation: RRID:Addgene_47709 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X