Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Flag-NEILE2-PUFa-TET1(CD)
Vector Backbone Description: Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134849 Copy
Species: Homo sapiens
Genetic Insert: PUFa-NEIL2-TET1(CD)
Vector Backbone Description: Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134850 Copy
Species: Homo sapiens
Genetic Insert: PUFc-NEIL2
Vector Backbone Description: Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134851 Copy
Species: Homo sapiens
Genetic Insert: 3xFlag-GADD45A-PUFa-dTET1(CD)H1671Y D1673A)
Vector Backbone Description: Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134870 Copy
Species: Homo sapiens
Genetic Insert: 3xFlag-GADD45A(G39A)-PUFa-TET1(CD)
Vector Backbone Description: Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134871 Copy
Species: Homo sapiens
Genetic Insert: 3xFlag-GADD45A(G39A L77E)-PUFa-TET1(CD)
Vector Backbone Description: Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134873 Copy
Vector Backbone Description: Backbone Size:4723; Vector Backbone:pX330; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31541098
Proper citation: RRID:Addgene_134979 Copy
Species: Mus musculus
Genetic Insert: mTERT
Vector Backbone Description: Backbone Marker:Bob Weinberg (Addgene Plasmid #1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21732358
Proper citation: RRID:Addgene_36413 Copy
Vector Backbone Description: Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_37504 Copy
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through
Proper citation: RRID:Addgene_37505 Copy
Vector Backbone Description: Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8R adds a TEV-cleavable strep tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ .
Proper citation: RRID:Addgene_37506 Copy
Species: Mus musculus
Genetic Insert: mMCL1(T144A)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25386 Copy
Species: Mus musculus
Genetic Insert: mMCL1(T144D)
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25388 Copy
Species: Homo sapiens
Genetic Insert: hDna2
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBabe hygro 3xFLAG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22570476
Comments: to get 3XFLAG hDna2 out cut with BAMH1 and SAL1
Proper citation: RRID:Addgene_31955 Copy
Species: Mus musculus
Genetic Insert: CD47
Vector Backbone Description: Backbone Marker:Jeng-Shin Lee, Harvard University; Backbone Size:6079; Vector Backbone:AAV-MCS8; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34197341
Proper citation: RRID:Addgene_168479 Copy
Genetic Insert: HaloTag-GFP-mito
Vector Backbone Description: Vector Backbone:AAV-CMV-GFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35034446
Proper citation: RRID:Addgene_182201 Copy
Species: Homo sapiens
Genetic Insert: hNGN2-P2A-EMX1
Vector Backbone Description: Backbone Size:13225; Vector Backbone:pUCM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182312 Copy
Vector Backbone Description: Backbone Size:4888; Vector Backbone:pBABE-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2194165
Comments: Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication:
Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96.
SspI site in Amp gene.
If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC.
Proper citation: RRID:Addgene_1766 Copy
Species: Homo sapiens
Genetic Insert: YTHDC1
Vector Backbone Description: Vector Backbone:modified from Addgene 61425; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34375583
Proper citation: RRID:Addgene_177129 Copy
Species: Homo sapiens
Genetic Insert: Heat Shock Factor 1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11486022
Comments: contains the FLAG epitope amino terminal to the GAL4 DNA binding domain (amino acids 1 to 94), attached to the C terminus of hHSF1, (amino acids 201 to 529). This construct was subcloned into the pBABE/puro retroviral vector via the BglII and EcoRI sites. Acidic Mutant. (Kingston #1153)
Proper citation: RRID:Addgene_1946 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.