Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAT608_CMV/CAG_Flag-hNEIL2-PUFa-hTET1(CD) Resource Report Resource Website |
RRID:Addgene_134849 | Flag-NEILE2-PUFa-TET1(CD) | Homo sapiens | Ampicillin | PMID:31541098 | Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:43 | 0 | ||
|
pAT611_CMV/CAG_PUFa-hNEIL2-hTET1(CD) Resource Report Resource Website |
RRID:Addgene_134850 | PUFa-NEIL2-TET1(CD) | Homo sapiens | Ampicillin | PMID:31541098 | Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:44 | 0 | ||
|
pAT595_CMV/CAG_PUFc-hNEIL2 Resource Report Resource Website |
RRID:Addgene_134851 | PUFc-NEIL2 | Homo sapiens | Ampicillin | PMID:31541098 | Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 12:55:43 | 0 | ||
|
pAT976_CMV/CAG_Flag-hGADD45A-PUFa-dTET1CD Resource Report Resource Website |
RRID:Addgene_134870 | 3xFlag-GADD45A-PUFa-dTET1(CD)H1671Y D1673A) | Homo sapiens | Ampicillin | PMID:31541098 | Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | TET1 ( H1671Y D1673A) | 2026-08-29 12:55:44 | 0 | |
|
pAT971_CMV/CAG_Flag-hGADD45A (G39A)-PUFa-hTET1(CD) Resource Report Resource Website |
RRID:Addgene_134871 | 3xFlag-GADD45A(G39A)-PUFa-TET1(CD) | Homo sapiens | Ampicillin | PMID:31541098 | Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | GADD45A (G38A) | 2026-08-29 12:55:44 | 0 | |
|
pAT973_CMV/CAG_FlaghGADD45A (G39A, L77E)-PUFa-hTET1(CD) Resource Report Resource Website |
RRID:Addgene_134873 | 3xFlag-GADD45A(G39A L77E)-PUFa-TET1(CD) | Homo sapiens | Ampicillin | PMID:31541098 | Backbone Marker:Plasmid #25896; Backbone Size:9573; Vector Backbone:pLX302; Vector Types:Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | GADD45A (L77E) | 2026-08-29 12:55:44 | 0 | |
|
pAT1504_pX-SPFE-BbsI(ccdbCam)-5xPBSc Resource Report Resource Website |
RRID:Addgene_134979 | Chloramphenicol and Ampicillin | PMID:31541098 | Backbone Size:4723; Vector Backbone:pX330; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 12:55:44 | 0 | ||||
|
mTert-pBabe-puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_36413 | mTERT | Mus musculus | Ampicillin | PMID:21732358 | Backbone Marker:Bob Weinberg (Addgene Plasmid #1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:32 | 5 | ||
|
pBad His6 mOCR TEV LIC cloning vector (8O) Resource Report Resource Website |
RRID:Addgene_37504 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8O adds a TEV-cleavable His6-mOCR tag to the N-terminus of your protein. mOCR can enhance the solubility of your protein of interest. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6053; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:42 | 0 | ||||
|
pBAD Strep His6 TEV LIC cloning vector (8HR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37505 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through | Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:40 | 1 | ||||
|
pBAD Strep TEV LIC cloning vector (8R) Resource Report Resource Website |
RRID:Addgene_37506 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8R adds a TEV-cleavable strep tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ . | Backbone Size:5693; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:40 | 0 | ||||
|
pBabe-HA-mMcl-1(T144A) Resource Report Resource Website |
RRID:Addgene_25386 | mMCL1(T144A) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | changed threonine 144 to alanine | 2026-08-29 01:02:39 | 0 | |
|
pBabe-HA-mMcl-1(T144D) Resource Report Resource Website 1+ mentions |
RRID:Addgene_25388 | mMCL1(T144D) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | P142T T144D | 2026-08-29 01:02:39 | 1 | |
|
pBabe hygro 3xFLAG Dna2 wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_31955 | hDna2 | Homo sapiens | Ampicillin | PMID:22570476 | to get 3XFLAG hDna2 out cut with BAMH1 and SAL1 | Backbone Size:5200; Vector Backbone:pBabe hygro 3xFLAG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Changed start ATG to AAA, | 2026-08-29 01:03:54 | 3 |
|
AAV-hRedOpsin-CD47 Resource Report Resource Website |
RRID:Addgene_168479 | CD47 | Mus musculus | Ampicillin | PMID:34197341 | Backbone Marker:Jeng-Shin Lee, Harvard University; Backbone Size:6079; Vector Backbone:AAV-MCS8; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:46 | 0 | ||
|
AAV-HGM Resource Report Resource Website |
RRID:Addgene_182201 | HaloTag-GFP-mito | Ampicillin | PMID:35034446 | Vector Backbone:AAV-CMV-GFP; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:26 | 0 | |||
|
PB-TO-NGN2-EMX1 puro-BFP Resource Report Resource Website |
RRID:Addgene_182312 | hNGN2-P2A-EMX1 | Homo sapiens | Ampicillin | Backbone Size:13225; Vector Backbone:pUCM; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:27 | 0 | |||
|
pBABE-zeo (pBABE-bleo) Resource Report Resource Website 10+ mentions |
RRID:Addgene_1766 | Ampicillin | PMID:2194165 | Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication: Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96. SspI site in Amp gene. If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC. | Backbone Size:4888; Vector Backbone:pBABE-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:00:48 | 12 | |||
|
pLenti-Ef1a-mClover-YTHDC1-T2A-BSD-siRNA-Resistant Resource Report Resource Website 1+ mentions |
RRID:Addgene_177129 | YTHDC1 | Homo sapiens | Ampicillin | PMID:34375583 | Vector Backbone:modified from Addgene 61425; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | siRNA resistant silent mutations | 2026-08-29 01:00:53 | 1 | |
|
pBABE Gal4(1-94) HSF ABC Flag ac Resource Report Resource Website |
RRID:Addgene_1946 | Heat Shock Factor 1 | Homo sapiens | Ampicillin | PMID:11486022 | contains the FLAG epitope amino terminal to the GAL4 DNA binding domain (amino acids 1 to 94), attached to the C terminus of hHSF1, (amino acids 201 to 529). This construct was subcloned into the pBABE/puro retroviral vector via the BglII and EcoRI sites. Acidic Mutant. (Kingston #1153) | Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | acidic mutant (D416, E493, E496 A) | 2026-08-29 01:01:44 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.