Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110616 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110617 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110618 Copy
Species: Other
Genetic Insert: araC-ParaBAD
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:5610; Vector Backbone:miniCTX1; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:27613678
Proper citation: RRID:Addgene_110567 Copy
Species: Synthetic
Genetic Insert: GFP dropout
Vector Backbone Description: Vector Backbone:R6K; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110600 Copy
Species: Synthetic
Genetic Insert: GFP dropout
Vector Backbone Description: Vector Backbone:R6K; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110601 Copy
Species: Mus musculus
Genetic Insert: Talin 1
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_110565 Copy
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110605 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110603 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110608 Copy
Species: Synthetic
Genetic Insert: sgRNA
Vector Backbone Description: Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110609 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:RSF1010; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29608282
Proper citation: RRID:Addgene_110607 Copy
Species: Homo sapiens
Genetic Insert: Paf1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGCCCACCATCCAG 3' and 5' CCGCTCGAGTCAGTCACTGTCACTATCAGCTTCACTG 3'
Proper citation: RRID:Addgene_11059 Copy
Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Comments: Addgene sequencing data finds T189A and D332G substitutions. These are not known to affect function.
Proper citation: RRID:Addgene_11055 Copy
Species: Rattus norvegicus
Genetic Insert: HDGF
Vector Backbone Description: Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Comments: *Note there is a Q104R mutation in the plasmid that is unlikely to affect plasmid function.
Proper citation: RRID:Addgene_11058 Copy
Species: Homo sapiens
Genetic Insert: HRPT2 L64P
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Used plasmid 11048 as a template for mutagenesis using the following primers: 5' G GAT TCC ATT TTA TTT CTA CCT AAT AAC GTG CAC CTT TCT C 3' and 5' G AGA AAG GAG CAC GTT ATT AGG TAG AAA TAA AAT GGA ATC C 3'
Proper citation: RRID:Addgene_11052 Copy
Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Proper citation: RRID:Addgene_11054 Copy
Species: Mus musculus
Genetic Insert: HDAC1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15060137
Comments: pCIG drives simultaneous expression of GFP and inserted genes by virtue of an internal ribosome entry site.
Proper citation: RRID:Addgene_11053 Copy
Species: RD114 retrovirus
Genetic Insert: anit-RD114 light chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3456; Vector Backbone:pFUSEss; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Blasticidin
Defining Citation: PMID:31702531
Proper citation: RRID:Addgene_110556 Copy
Species: Other
Genetic Insert: araC-ParaBAD
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18T-miniTn7T-gm; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27613678
Proper citation: RRID:Addgene_110554 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
