Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 86 showing 1701 ~ 1720 out of 2,249 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_158520

http://www.addgene.org/158520

Species: Arabidopsis thaliana
Genetic Insert: ZAR1-eGFP
Vector Backbone Description: Backbone Marker:https://www.addgene.org/48076/; Vector Backbone:pICH86988; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34633454

Proper citation: RRID:Addgene_158520 Copy   


  • RRID:Addgene_170877

http://www.addgene.org/170877

Species: Arabidopsis thaliana
Genetic Insert: pAtUBQ10
Vector Backbone Description: Backbone Marker:Diego Orzaez Lab; Backbone Size:2105; Vector Backbone:pUPD2; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34520169
Comments: Insert can be excised by BsaI digestion . Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv

Proper citation: RRID:Addgene_170877 Copy   


  • RRID:Addgene_170884

http://www.addgene.org/170884

Species: Arabidopsis thaliana
Genetic Insert: HSP18.2t
Vector Backbone Description: Backbone Marker:Diego Orzaez Lab; Backbone Size:3057; Vector Backbone:pUPD; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34520169
Comments: Insert can be excised by BsaI digestion . Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv

Proper citation: RRID:Addgene_170884 Copy   


  • RRID:Addgene_66571

http://www.addgene.org/66571

Species: Arabidopsis thaliana
Genetic Insert: PhyB
Vector Backbone Description: Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26035630

Proper citation: RRID:Addgene_66571 Copy   


http://www.addgene.org/73394

Species: Arabidopsis thaliana
Genetic Insert: At4CL
Vector Backbone Description: Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26860871

Proper citation: RRID:Addgene_73394 Copy   


http://www.addgene.org/73392

Species: Arabidopsis thaliana
Genetic Insert: At4CL
Vector Backbone Description: Backbone Marker:Koffas Lab, Addgene Plasmid #49795; Backbone Size:5203; Vector Backbone:pETM6; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26860871

Proper citation: RRID:Addgene_73392 Copy   


  • RRID:Addgene_67908

http://www.addgene.org/67908

Species: Arabidopsis thaliana
Genetic Insert: PIAL2
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:6700; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25415977

Proper citation: RRID:Addgene_67908 Copy   


  • RRID:Addgene_67917

http://www.addgene.org/67917

Species: Arabidopsis thaliana
Genetic Insert: CTG10
Vector Backbone Description: Backbone Marker:Invitrogen; life technologies Thermo Fisher Scientific; Backbone Size:4761; Vector Backbone:Gateway® pDONR™221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29632208

Proper citation: RRID:Addgene_67917 Copy   


  • RRID:Addgene_67871

http://www.addgene.org/67871

Species: Arabidopsis thaliana
Genetic Insert: PRORP3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28-b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22976545

Proper citation: RRID:Addgene_67871 Copy   


  • RRID:Addgene_68017

http://www.addgene.org/68017

Species: Arabidopsis thaliana
Genetic Insert: PHY-INTERACTING FACTOR 1 (PIF1)
Vector Backbone Description: Backbone Marker:Novagen; EMD Millipore; Backbone Size:3666; Vector Backbone:pET23b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29632208

Proper citation: RRID:Addgene_68017 Copy   


  • RRID:Addgene_68255

http://www.addgene.org/68255

Species: Arabidopsis thaliana
Genetic Insert: Promoter_AtU6-26 + sgRNA_BolC.GA4a-1
Vector Backbone Description: Vector Backbone:pICH47751 (AddGene #48002); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Comments: Target sequence: GTTTTCACTTGCGGCCGGAG

Proper citation: RRID:Addgene_68255 Copy   


  • RRID:Addgene_68208

http://www.addgene.org/68208

Species: Arabidopsis thaliana
Genetic Insert: AtU6-26 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68208 Copy   


  • RRID:Addgene_68164

http://www.addgene.org/68164

Species: Arabidopsis thaliana
Genetic Insert: AtML1 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68164 Copy   


  • RRID:Addgene_68177

http://www.addgene.org/68177

Species: Arabidopsis thaliana
Genetic Insert: AtAct2 promoter (no UTR)
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68177 Copy   


  • RRID:Addgene_68178

http://www.addgene.org/68178

Species: Arabidopsis thaliana
Genetic Insert: 5'UTR AtAct2
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68178 Copy   


  • RRID:Addgene_68191

http://www.addgene.org/68191

Species: Arabidopsis thaliana
Genetic Insert: AtAct2 terminator
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68191 Copy   


  • RRID:Addgene_68186

http://www.addgene.org/68186

Species: Arabidopsis thaliana
Genetic Insert: AtHsp18.2 terminator
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68186 Copy   


  • RRID:Addgene_68192

http://www.addgene.org/68192

Species: Arabidopsis thaliana
Genetic Insert: AtUbq3 terminator
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68192 Copy   


  • RRID:Addgene_68504

http://www.addgene.org/68504

Species: Arabidopsis thaliana
Genetic Insert: OPTX promoter
Vector Backbone Description: Backbone Marker:Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1); Backbone Size:7272; Vector Backbone:pLUC Trap3 (GW); Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24206622

Proper citation: RRID:Addgene_68504 Copy   


  • RRID:Addgene_69490

http://www.addgene.org/69490

Species: Arabidopsis thaliana
Genetic Insert: GSGGGG spacer-Degron-TEV protease site-3x FLAG epitope
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, template to generate cassettes for -mediated knock-in; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26552885

Proper citation: RRID:Addgene_69490 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X