Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 86 showing 1701 ~ 1720 out of 30,615 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/117327

Species: Synthetic
Genetic Insert: miR-124 sponge
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:7334; Vector Backbone:pmiRGLO; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30292704

Proper citation: RRID:Addgene_117327 Copy   


  • RRID:Addgene_117396

http://www.addgene.org/117396

Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859

Proper citation: RRID:Addgene_117396 Copy   


  • RRID:Addgene_117395

http://www.addgene.org/117395

Species: Synthetic
Genetic Insert: dTomato
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859

Proper citation: RRID:Addgene_117395 Copy   


  • RRID:Addgene_117388

http://www.addgene.org/117388

Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pGEN-mcs (ori15A); Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859

Proper citation: RRID:Addgene_117388 Copy   


http://www.addgene.org/117384

Species: Synthetic
Genetic Insert: GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
Vector Backbone Description: Backbone Size:5352; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30626963

Proper citation: RRID:Addgene_117384 Copy   


  • RRID:Addgene_117392

http://www.addgene.org/117392

Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859

Proper citation: RRID:Addgene_117392 Copy   


  • RRID:Addgene_117391

    This resource has 1+ mentions.

http://www.addgene.org/117391

Species: Synthetic
Genetic Insert: dTomato
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859

Proper citation: RRID:Addgene_117391 Copy   


  • RRID:Addgene_117394

    This resource has 1+ mentions.

http://www.addgene.org/117394

Species: Synthetic
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859

Proper citation: RRID:Addgene_117394 Copy   


  • RRID:Addgene_117383

http://www.addgene.org/117383

Species: Synthetic
Genetic Insert: EYFP
Vector Backbone Description: Backbone Size:4751; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30626963

Proper citation: RRID:Addgene_117383 Copy   


http://www.addgene.org/117409

Species: Synthetic
Genetic Insert: SauCas9 sgRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_117409 Copy   


http://www.addgene.org/117406

Species: Synthetic
Genetic Insert: SpyCas9 sgRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_117406 Copy   


  • RRID:Addgene_117503

http://www.addgene.org/117503

Species: Synthetic
Genetic Insert: BpiI:tagt:UBI10:Cas9-3(intron):E9:ttgc:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47811; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.

Proper citation: RRID:Addgene_117503 Copy   


  • RRID:Addgene_117502

http://www.addgene.org/117502

Species: Synthetic
Genetic Insert: BpiI:GCAA:UBI10:Cas9-3(intron):E9:ACTA:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47742; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.

Proper citation: RRID:Addgene_117502 Copy   


http://www.addgene.org/117411

Species: Synthetic
Genetic Insert: AsCas12a gRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_117411 Copy   


  • RRID:Addgene_117412

    This resource has 1+ mentions.

http://www.addgene.org/117412

Species: Synthetic
Genetic Insert: FnCas12a gRNA targeting TLR 2.0
Vector Backbone Description: Vector Backbone:pBluescript SK (+); Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36070530
Comments: Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_117412 Copy   


  • RRID:Addgene_117597

http://www.addgene.org/117597

Species: Synthetic
Genetic Insert: [35S:Sp-eCas9 1.0(pEPOR1CB0010) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint

Proper citation: RRID:Addgene_117597 Copy   


  • RRID:Addgene_117594

http://www.addgene.org/117594

Species: Synthetic
Genetic Insert: [35S:Sp-eCas9 1.0(pEPOR1CB0010) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint

Proper citation: RRID:Addgene_117594 Copy   


  • RRID:Addgene_117593

http://www.addgene.org/117593

Species: Synthetic
Genetic Insert: [35S:SpCas9-KA(pEPOR1CB0009) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint

Proper citation: RRID:Addgene_117593 Copy   


  • RRID:Addgene_117518

http://www.addgene.org/117518

Species: Synthetic
Genetic Insert: BpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson. Primers to amplify a sgRNA: Fw: ga GGTCTCa ATTG [x] GTTTAAGAGCTATGCTGGAA, where [x] is the 20nt spacer/target sequence (NOT including the PAM). Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC (for polyT terminator) tgtggtctcaAGCGACCCCAGAAATTGAAC (for 67 bp U6-26 terminator, recommanded) tgtggtctcaAGCGTATTGGTTTATCTCATCG (for 192 bp U6-26 terminator). The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.

Proper citation: RRID:Addgene_117518 Copy   


  • RRID:Addgene_117517

http://www.addgene.org/117517

Species: Synthetic
Genetic Insert: BpiI:ACTA:pU6-26:sgRNA:polyT:TTAC:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson. Primers to amplify a sgRNA: Fw: ga GGTCTCa ATTG [x] GTTTTAGAGCTAGAAATAGC, where [x] is the 20nt spacer/target sequence (NOT including the PAM). Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC. The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.

Proper citation: RRID:Addgene_117517 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X