Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: pex15
Vector Backbone Description: Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32541053
Proper citation: RRID:Addgene_226894 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pex15
Vector Backbone Description: Vector Backbone:pACYCDue; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32541053
Proper citation: RRID:Addgene_226893 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: msp1
Vector Backbone Description: Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32541053
Proper citation: RRID:Addgene_226891 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: msp1
Vector Backbone Description: Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32541053
Proper citation: RRID:Addgene_226890 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: spt6-tsh2
Vector Backbone Description: Backbone Size:5429; Vector Backbone:pDEST15; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_227088 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: tom1p-HECT
Vector Backbone Description: Backbone Size:4353; Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_227089 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pex15
Vector Backbone Description: Vector Backbone:pET-DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32541053
Proper citation: RRID:Addgene_226906 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MWG-ubiquitin-G77-C78
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36350544
Proper citation: RRID:Addgene_224249 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MC-Ub-3C-His
Vector Backbone Description: Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36736315
Proper citation: RRID:Addgene_224258 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ubc4
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26301997
Proper citation: RRID:Addgene_226361 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SARS-CoV-2 BA.2.86 RBD
Vector Backbone Description: Vector Backbone:pETcon; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39310091
Proper citation: RRID:Addgene_222231 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CDC42pr-GFP1-10
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFA6-NATMX; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86420 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CDC42pr-KAR2SS-GFP1-10
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pFA6-NATMX; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27831485
Proper citation: RRID:Addgene_86421 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VMA intein
Vector Backbone Description: Vector Backbone:pMAL-c5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28186733
Comments: TGTCCTACTCAGGAGAGCGTTCAC to sequence VMA C-term; and ACCCATGACCTTATTACCAACCTC to sequence the insert between MBP C-term and VMA
Proper citation: RRID:Addgene_86590 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1 upstream of HIS3
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC119; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10793159
Comments: UB1 fragment (SphI-SacI) from pRB306 inserted into SphI-SacI-cut polylinker of pUC119. Then, SalI-KpnI (partial) fragment from pJJ217 containing the entire HIS3 gene and flanking regions, inserted into XhoI-KpnI vector fragment; HIS3 is in the same orientation that TUB1 was; note that this disruption construct removes the first 763 bp of the 1580-bp ORF downstream of TUB1 (YML086c). For information on pUC119, search for pUC119 in Addgene's vector db.
Proper citation: RRID:Addgene_8670 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1
Vector Backbone Description: Backbone Marker:Botstein et al. Gene. 1979 8(1):17-24.; Backbone Size:0; Vector Backbone:YEp21; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3540600
Comments: A TUB1 fragment was ligated from the SphI site (1.1 kilobases before the start codon) to a BglII site (0.5 kb beyond the stop codon) in place of the small SphI-to-BamHI (??) fragment of YEp21. For more information on YEp21, search for YEp21 in Addgene's vector db.
Proper citation: RRID:Addgene_8668 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1-D252A under GAL1 promoter
Vector Backbone Description: Backbone Size:0; Vector Backbone:pTS210; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739794
Comments: PCRed TUB1-D252A products were digested with BamHI and SpeI and ligated to the BamHI and XbaI sites of pTS210. The vector plasmid pTS210, a YCp50-based construct, contained the GAL1/GAL10 promoter, a short polylinker (BamHI, HindIII, XbaI), and the ACT1 transcriptional terminator.
Proper citation: RRID:Addgene_8673 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB1-828 under GAL1 promoter
Vector Backbone Description: Backbone Size:0; Vector Backbone:pTS210; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739794
Comments: TUB1-828 was from Richards et al 2000 Mol. Biol. Cell 11, 1887-1903. It was PCRed, and the PCR products were digested with BamHI and SpeI and ligated to the BamHI and XbaI sites of pTS210. The vector plasmid pTS210, a YCp50-based construct, contained the GAL1/GAL10 promoter, a short polylinker (BamHI, HindIII, XbaI), and the ACT1 transcriptional terminator.
Please note that this construct is missing the first 8 amino acids of the TUB1 ORF. This deletion has no effect on the plasmid function as the 2 point mutations make this a dominant lethal allele.
Proper citation: RRID:Addgene_8672 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GFP::TUB1-828 under GAL1 promoter
Vector Backbone Description: Backbone Size:0; Vector Backbone:pTS408; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739794
Comments: PCR amplified TUB1-828 DNA were digested with BamHI and SpeI and ligated to the BamHI and XbaI sites of pTS408. pTS408 was constructed by PCR amplifying GFP with BamHI and BglII sites and by inserting this into the BamHI site of pTS210, creating a plasmid with the polylinker downstream of GFP to create NH2-terminal GFP fusions.The vector plasmid pTS210, a YCp50-based construct, contained the GAL1/GAL10 promoter, a short polylinker (BamHI, HindIII, XbaI), and the ACT1 transcriptional terminator.
Proper citation: RRID:Addgene_8678 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: tub1-827 under GAL1 promoter
Vector Backbone Description: Backbone Size:0; Vector Backbone:pTS210; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739794
Comments: tub1-827 was from Richards et al 2000 Mol. Biol. Cell 11, 1887-1903. It was PCRed, and the PCR products were digested with BamHI and SpeI and ligated to the BamHI and XbaI sites of pTS210. The vector plasmid pTS210, a YCp50-based construct, contained the GAL1/GAL10 promoter, a short polylinker (BamHI, HindIII, XbaI), and the ACT1 transcriptional terminator.
Proper citation: RRID:Addgene_8676 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.