Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: abu-1 promoter and coding region
Vector Backbone Description: Backbone Marker:Available at Addgene (#1494); Backbone Size:4487; Vector Backbone:pPD95_75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12186849
Comments: Addgene sequencing results show there is a S408P substitution in amino acid sequence in the coding region.
abu-1::abu-1::gfp C. elegans reporter gene. The promoter and coding region of abu-1 was ligated in frame with GFP to produce abu1::abu-1::gfp
Proper citation: RRID:Addgene_21825 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-119 rescuing fragment / pie-1promoter-GFP- gateway destination cassette B -pie-1 3’
Vector Backbone Description: Backbone Size:16320; Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16499902
Comments: Use ONLY DB3.1 to transform this plasmid. DH5 alpha does not work (it has a death gene).
Proper citation: RRID:Addgene_22720 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTurquoise2-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37351566
Comments: pDD315 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015). It has a 2xHA tag in place of 3xFlag, and Lox511I sites in place of LoxP. These features allow pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between epitope tags and Lox sites.
Proper citation: RRID:Addgene_73343 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmyo-2::GFP + SEC
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34903234
Comments: pDD317 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015) and is intended for making gene knockouts. It has a Pmyo-2::GFP expression cassette (bright pharyngeal fluorescence) in place of the simple fluorescent protein found in our other FP–SEC vectors. Pmyo-2::GFP + SEC is intended to be inserted in place of an entire ORF such that after insertion and SEC removal, the knockout is marked with Pmyo-2::GFP. The vector also has Lox511I sites in place of LoxP, allowing pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between Lox sites.
Proper citation: RRID:Addgene_73344 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-70::TSMod
Vector Backbone Description: Vector Backbone:pEXPR; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24561618
Proper citation: RRID:Addgene_73367 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::mKate2::PH::tbb-2
Vector Backbone Description: Vector Backbone:modified pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27385332
Proper citation: RRID:Addgene_73512 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::mCherryo::PH::tbb-2
Vector Backbone Description: Vector Backbone:modified pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27385332
Proper citation: RRID:Addgene_73511 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::TagRFP-T::PH::tbb-2
Vector Backbone Description: Vector Backbone:modified pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27385332
Proper citation: RRID:Addgene_73517 Copy
Species: Caenorhabditis elegans
Genetic Insert: Punc-17::2xNLS-FLP-D5::let-858 3'-UTR
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73685 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP + Cbr-unc-119
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Comments: Also encodes PU6::sgRNA cassette; The sgRNA targeting sequence can be sequenced with oMLS471: 5'-TCCAAGAACTCGTACAAAAATGCTC
Proper citation: RRID:Addgene_73682 Copy
Species: Caenorhabditis elegans
Genetic Insert: Punc-47::2xNLS-FLP-D5::let-858 3'-UTR
Vector Backbone Description: Vector Backbone:pCFJ201; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73687 Copy
Species: Caenorhabditis elegans
Genetic Insert: HIS-72
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Worm Expression, For MosSCI insertion; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26632265
Proper citation: RRID:Addgene_73584 Copy
Species: Caenorhabditis elegans
Genetic Insert: SL2 (gdp-2/gdp-3 intergenic region)
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73726 Copy
Species: Caenorhabditis elegans
Genetic Insert: Psnt-1::2xNLS-FLP-D5
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73718 Copy
Species: Caenorhabditis elegans
Genetic Insert: STOP codon + let-858 3'-UTR
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73737 Copy
Species: Caenorhabditis elegans
Genetic Insert: 2xNLS-FLP-D5
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pDONR221; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26837755
Proper citation: RRID:Addgene_73739 Copy
Species: Caenorhabditis elegans
Genetic Insert: RSF-1
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66862 Copy
Species: Caenorhabditis elegans
Genetic Insert: Let-60
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66860 Copy
Species: Caenorhabditis elegans
Genetic Insert: YPET-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Proper citation: RRID:Addgene_66824 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]
Proper citation: RRID:Addgene_66823 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
