Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: human Dynamin 1aa
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22163 Copy
Species: Homo sapiens
Genetic Insert: calcium-modulating ligand
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22284 Copy
Species: mixture
Genetic Insert: EGFP-ER
Vector Backbone Description: Backbone Size:6959; Vector Backbone:pMH4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: EGFP(A206K)= 925-1707
Calreticulin sgnalseq.=862-912
KDEL coding seq.=1714-1725
Proper citation: RRID:Addgene_22285 Copy
Species: Arabidopsis thaliana
Genetic Insert: p!SV40-PakGBD-mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4864; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22280 Copy
Species: Homo sapiens
Genetic Insert: hBEN
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Homologous to mouse BEN 1alpha1 isoform
Proper citation: RRID:Addgene_22160 Copy
Species: Arabidopsis thaliana
Genetic Insert: p!SV40-mCherry-WaspGBD
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5216; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22281 Copy
Species: Homo sapiens
Genetic Insert: Snk/Plk2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/V5-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Human Snk/Plk2 was amplified from a human fetal brain cDNA library (Clontech) using PFU Turbo (Invitrogen) using the following primers: 5' CGC GGA TCC GCG ACC ATG GAG CTT TTG 3' and 5' CCG CTC GAG GTT ACA TCT TTG TAA GAG CAT 3'.
Proper citation: RRID:Addgene_22218 Copy
Species: Homo sapiens
Genetic Insert: Snk/Plk2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/V5-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Human Snk/Plk2 was amplified from a human fetal brain cDNA library (Clontech) using PFU Turbo (Invitrogen) using the following primers: 5' CGC GGA TCC GCG ACC ATG GAG CTT TTG 3' and 5' CCG CTC GAG GTT ACA TCT TTG TAA GAG CAT 3'.
Proper citation: RRID:Addgene_22219 Copy
Species: Homo sapiens
Genetic Insert: Tuba
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22214 Copy
Species: Drosophila melanogaster
Genetic Insert: SCP1 (super core promoter 1)-CMVenh luciferase
Vector Backbone Description: Backbone Size:5500; Vector Backbone:Vector Backbone: a MODIFIED version (constructed by us) of Invit; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22216 Copy
Species: Homo sapiens
Genetic Insert: SA-OCT-GFP-2APuro-PA
Vector Backbone Description: Backbone Size:5468; Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22211 Copy
Species: Homo sapiens
Genetic Insert: CAGGS-eGFP
Vector Backbone Description: Backbone Size:7357; Vector Backbone:N/A; Vector Types:ZFN donor; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid contains a ccdB gene that is non-functional.
Proper citation: RRID:Addgene_22212 Copy
Species:
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2386; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Yeast Expression, Worm Expression, Insect Expression; Bacterial Resistance:Kanamycin
References:
Comments: Please note that there are several sequence discrepancies between Addgene's quality control sequence and the depositor's reference sequence. These changes do not affect plasmid function.
Proper citation: RRID:Addgene_22265 Copy
Species:
Genetic Insert: Enhanced Green Fluorescent Protein
Vector Backbone Description: Backbone Marker:Eric Campeau; Backbone Size:6869; Vector Backbone:pQCXIB; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22266 Copy
Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase inhibitor 2A
Vector Backbone Description: Backbone Size:8221; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22260 Copy
Species: Homo sapiens
Genetic Insert: HRAS G12V
Vector Backbone Description: Backbone Size:8176; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22262 Copy
Species: Homo sapiens
Genetic Insert: hBEN
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: GFP cloned in SpeI/ClaI
Proper citation: RRID:Addgene_22159 Copy
Species: Arabidopsis thaliana
Genetic Insert: PIF6APB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4860; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22276 Copy
Species: Arabidopsis thaliana
Genetic Insert: IntersectinDHPH-20aaLinker-mYFP-PIF6APB
Vector Backbone Description: Backbone Size:4860; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22278 Copy
Species:
Genetic Insert: shRNA Cyclin-dependent kinase inhibitor 2A (CDKN2A)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7801; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: shRNA oligo sequence is 5'-GACCGTAACTATTCGGTGCGTTGGGCAGAAGCTTGTGCTCAACGCACCGAATAGTTGCGGTCTTTTT
Proper citation: RRID:Addgene_22271 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
