Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: Eco1 editing ncRNA and gRNA, CAN1 G444X, a1/a2 length: 12
Vector Backbone Description: Vector Backbone:pZS165 (Addgene plasmid #114451); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34949838
Proper citation: RRID:Addgene_184975 Copy
Species: E. coli
Genetic Insert: Eco1 editing ncRNA and gRNA, CAN1 G444X, a1/a2 length: 27 v1
Vector Backbone Description: Vector Backbone:pZS165 (Addgene plasmid #114451); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34949838
Proper citation: RRID:Addgene_184976 Copy
Species: E. coli
Genetic Insert: Eco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
Vector Backbone Description: Vector Backbone:pFUGW-H1 (Addgene plasmid #25870); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34949838
Proper citation: RRID:Addgene_185001 Copy
Species: E. coli
Genetic Insert: Eco1 ncRNA (variants)
Vector Backbone Description: Vector Backbone:pRSFDUET-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34949838
Proper citation: RRID:Addgene_184955 Copy
Species: E. coli
Genetic Insert: 35S::nptII-T-Nos
Vector Backbone Description: Backbone Size:4377; Vector Backbone:n/a; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36995631
Proper citation: RRID:Addgene_191783 Copy
Species: E. coli
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pXD69m2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36494336
Proper citation: RRID:Addgene_191620 Copy
Species: E. coli
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pXD69m2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36494336
Proper citation: RRID:Addgene_191621 Copy
Species: E. coli
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pXD69m2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36494336
Proper citation: RRID:Addgene_191627 Copy
Species: E. coli
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pXD69m2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36494336
Proper citation: RRID:Addgene_191625 Copy
Species: E. coli
Genetic Insert: lacZ
Vector Backbone Description: Vector Backbone:pXD69m2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:36494336
Proper citation: RRID:Addgene_191629 Copy
Species: E. coli
Genetic Insert: CysGA-Im7 F84A
Vector Backbone Description: Backbone Size:3904; Vector Backbone:pTrc-99a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33753520
Proper citation: RRID:Addgene_201082 Copy
Species: E. coli
Genetic Insert: CysGA-Im7
Vector Backbone Description: Backbone Size:3904; Vector Backbone:pTrc-99a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33753520
Proper citation: RRID:Addgene_201081 Copy
Species: E. coli
Genetic Insert: E. coli tRNA Guanine Transglycosylase
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:5874; Vector Backbone:(T7)-2 Vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36988146
Proper citation: RRID:Addgene_206495 Copy
Species: E. coli
Genetic Insert: ykgMO-IGS
Vector Backbone Description: Backbone Marker:p15A ori plasmid; Backbone Size:4770; Vector Backbone:pJBL5034; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37523538
Proper citation: RRID:Addgene_207231 Copy
Species: E. coli
Genetic Insert: ykgMO-IGS
Vector Backbone Description: Backbone Marker:p15A ori plasmid; Backbone Size:2269; Vector Backbone:pJBL5034; Vector Types:Bacterial Expression, Luciferase, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:37523538
Proper citation: RRID:Addgene_207232 Copy
Species: E. coli
Genetic Insert: Enzyme BirA
Vector Backbone Description: Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9887208
Proper citation: RRID:Addgene_209131 Copy
Species: E. coli
Genetic Insert: ptsI
Vector Backbone Description: Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823
Proper citation: RRID:Addgene_182962 Copy
Species: E. coli
Genetic Insert: gRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
Vector Backbone Description: Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38252823
Proper citation: RRID:Addgene_182959 Copy
Species: E. coli
Genetic Insert: xylitol dehydrogenase
Vector Backbone Description: Vector Backbone:pMB1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35842981
Comments: Producing aromatic amino acid from corn husk by using polyols as intermediates (DOI: 10.1016/j.biomaterials.2022.121661)
Proper citation: RRID:Addgene_212151 Copy
Species: E. coli
Genetic Insert: Cas7, Cas5, Cas8, Cas11, Cas6, and Cas3
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pPV; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31811138
Proper citation: RRID:Addgene_204619 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
