Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 74 showing 1461 ~ 1480 out of 1,664 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_19678

http://www.addgene.org/19678

Species: Caenorhabditis elegans
Genetic Insert: Gateway(R1-R2)-L4440
Vector Backbone Description: Backbone Size:0; Vector Backbone:L4440; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19678 Copy   

    • RRID:Addgene_19677

http://www.addgene.org/19677

Species: Caenorhabditis elegans
Genetic Insert: Gateway(R4-R3)Vector Backbone Description: Backbone Size:0; Vector Backbone:pGC249; Vector Types:Worm Expression, FLP/FRT, destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19677 Copy   

    • RRID:Addgene_19702

    This resource has 10+ mentions.

http://www.addgene.org/19702

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7624; Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_19702 Copy   

    • RRID:Addgene_19704

    This resource has 1+ mentions.

http://www.addgene.org/19704

Genetic Insert: pgLAP3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8325; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_19704 Copy   

    • RRID:Addgene_19706

    This resource has 1+ mentions.

http://www.addgene.org/19706

Genetic Insert: pgLAP5
Vector Backbone Description: Backbone Size:8365; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_19706 Copy   

    • RRID:Addgene_19705

http://www.addgene.org/19705

Genetic Insert: pgLAP4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7638; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_19705 Copy   

    • RRID:Addgene_26931

    This resource has 10+ mentions.

http://www.addgene.org/26931

Vector Backbone Description: Backbone Size:0; Vector Backbone:N/A; Vector Types:E.coli bacterial strain; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19633652
Comments: MG1655, bla, bio-, lambda-Red1, mutS–, cmR From the paper: mutS in EcNR1 was replaced with the chloramphenicol resistance gene (cmR cassette).

Proper citation: RRID:Addgene_26931 Copy   

    • RRID:Addgene_26955

http://www.addgene.org/26955

Species: Caenorhabditis elegans
Genetic Insert: unc-119 rescuing fragment/pie-1promoter-gateway destination cassette B- pie-1 3’
Vector Backbone Description: Backbone Size:17037; Vector Backbone:pie-1; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18692039
Comments: Second Generation pie-1 vector for expressing ORFs in the germline

Proper citation: RRID:Addgene_26955 Copy   

    • RRID:Addgene_26952

http://www.addgene.org/26952

Genetic Insert: pie-1promoter-GFP- gateway destination cassette B -pie-1 3’
Vector Backbone Description: Backbone Size:12296; Vector Backbone:pie-1; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18692039
Comments: For expressing GFP-ORF fusions in the germline. This vector does not contain unc-119 sequences and therefore must be co-injected with a marker (typically we use pRF4 in complex array injections - Kelly et al., 1997)

Proper citation: RRID:Addgene_26952 Copy   

    • RRID:Addgene_27367

http://www.addgene.org/27367

Genetic Insert: pUC/ori, bla
Vector Backbone Description: Backbone Marker:Gateway(R) (Invitrogen); Backbone Size:3012; Vector Backbone:pDONRP2R-P3; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21203517

Proper citation: RRID:Addgene_27367 Copy   

http://www.addgene.org/176585

Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176585 Copy   

http://www.addgene.org/161880

Vector Backbone Description: Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366

Proper citation: RRID:Addgene_161880 Copy   

http://www.addgene.org/161883

Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366

Proper citation: RRID:Addgene_161883 Copy   

http://www.addgene.org/161887

Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366

Proper citation: RRID:Addgene_161887 Copy   

http://www.addgene.org/161888

Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366

Proper citation: RRID:Addgene_161888 Copy   

    • RRID:Addgene_161878

    This resource has 1+ mentions.

http://www.addgene.org/161878

Vector Backbone Description: Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366

Proper citation: RRID:Addgene_161878 Copy   

    • RRID:Addgene_161783

    This resource has 1+ mentions.

http://www.addgene.org/161783

Vector Backbone Description: Backbone Size:10000; Vector Backbone:MA1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24388174

Proper citation: RRID:Addgene_161783 Copy   

    • RRID:Addgene_161786

    This resource has 1+ mentions.

http://www.addgene.org/161786

Vector Backbone Description: Backbone Size:10000; Vector Backbone:MA1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24388174

Proper citation: RRID:Addgene_161786 Copy   

    • RRID:Addgene_161785

    This resource has 1+ mentions.

http://www.addgene.org/161785

Vector Backbone Description: Backbone Size:10000; Vector Backbone:MA1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24388174

Proper citation: RRID:Addgene_161785 Copy   

    • RRID:Addgene_161890

http://www.addgene.org/161890

Vector Backbone Description: Vector Backbone:pET43.1a; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_161890 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch