Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: Ska1 MTBD-His
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29153323
Proper citation: RRID:Addgene_134141 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1 FL with YA mutant
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336
Proper citation: RRID:Addgene_134201 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1 aa 69-235
Vector Backbone Description: Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336
Proper citation: RRID:Addgene_134182 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1 aa 69 - 479
Vector Backbone Description: Backbone Marker:Song Tan (Addgene plasmid # 64008); Vector Backbone:pET3aTr; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336
Proper citation: RRID:Addgene_134187 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1 FL with oligomutant
Vector Backbone Description: Vector Backbone:pIC115_4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25411336
Proper citation: RRID:Addgene_134188 Copy
Species: Caenorhabditis elegans
Genetic Insert: KNL1
Vector Backbone Description: Vector Backbone:pRSETa; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_134190 Copy
Species: Caenorhabditis elegans
Genetic Insert: Myo 9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4673; Vector Backbone:pFast Bac 1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20538589
Comments: Sequencing of the C. elegans Myo9 cDNA that was obtained by reverse transcription-PCR revealed that it differed from the HUM-7 amino acid sequence at two positions. Residues 608–615 (VSPISPFW) were missing, and residues 731KKSAG735 were replaced by 731KSESAG736. Our deduced Myo9 amino acid sequence changes matched perfectly with the predicted Myo9 sequences for Caenorhabditis briggsae and Caenorhabditis remanei.
Proper citation: RRID:Addgene_134969 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pacr-2
Vector Backbone Description: Backbone Marker:Invitrogen Gateway; Backbone Size:4500; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20027209
Proper citation: RRID:Addgene_135092 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for cxTi10082 (actgttggatgcctgtgtag)
Vector Backbone Description: Backbone Marker:Goldstein Lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31378567
Proper citation: RRID:Addgene_135094 Copy
Species: Caenorhabditis elegans
Genetic Insert: DAF-2
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:7430; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Comments: This plasmid replaced plasmid pJH664 from the Zhen lab.
Proper citation: RRID:Addgene_132366 Copy
Species: Caenorhabditis elegans
Genetic Insert: INS-4
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:8291; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Proper citation: RRID:Addgene_132364 Copy
Species: Caenorhabditis elegans
Genetic Insert: INS-3
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:8291; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Proper citation: RRID:Addgene_132363 Copy
Species: Caenorhabditis elegans
Genetic Insert: INS-2
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:8291; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Proper citation: RRID:Addgene_132362 Copy
Species: Caenorhabditis elegans
Genetic Insert: INS-1
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:8291; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950
Proper citation: RRID:Addgene_132361 Copy
Species: Caenorhabditis elegans
Genetic Insert: EFF-1::mCherry::V5
Vector Backbone Description: Backbone Size:4498; Vector Backbone:pGENE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24725407
Proper citation: RRID:Addgene_133020 Copy
Species: Caenorhabditis elegans
Genetic Insert: EFF-1::V5
Vector Backbone Description: Backbone Marker:INVITROGEN; Backbone Size:4654; Vector Backbone:pGENE B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28137780
Proper citation: RRID:Addgene_132961 Copy
Species: Caenorhabditis elegans
Genetic Insert: C. elegans codon-optimized mNeonGreen
Vector Backbone Description: Backbone Size:2540; Vector Backbone:pDONR221; Vector Types:Worm Expression, CRISPR, SapTrap donor for cloning repair templates for C. elegans; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_133311 Copy
Species: Caenorhabditis elegans
Genetic Insert: EFF-1::V5
Vector Backbone Description: Backbone Size:4741; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21436398
Proper citation: RRID:Addgene_133584 Copy
Species: Caenorhabditis elegans
Genetic Insert: ACid Phosphatase family 2
Vector Backbone Description: Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23233530
Proper citation: RRID:Addgene_113051 Copy
Species: Caenorhabditis elegans
Genetic Insert: MiRP K+ channel accessory Subunit 1 1
Vector Backbone Description: Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12533541
Proper citation: RRID:Addgene_113057 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
