Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 71 showing 1401 ~ 1420 out of 2,180 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_187364

http://www.addgene.org/187364

Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b motor domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4694; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26195670
Comments: PCR cloning at EcoRI-XbaI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer ATGGCCAAGAAGGAGGTAAAAT and 3' primer CTGATATCGCTTTTGTTGCGCGT

Proper citation: RRID:Addgene_187364 Copy   


http://www.addgene.org/179074

Species: Rattus norvegicus
Genetic Insert: TEF2p-Scarlet(rfp)-Link-2xPH
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning

Proper citation: RRID:Addgene_179074 Copy   


http://www.addgene.org/179073

Species: Rattus norvegicus
Genetic Insert: TDH3p-Scarlet(rfp)-Link-2xPH
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning

Proper citation: RRID:Addgene_179073 Copy   


http://www.addgene.org/179072

Species: Rattus norvegicus
Genetic Insert: TDH3p-Neon(gfp)-Link-2xPH(PLCd)
Vector Backbone Description: Vector Backbone:pYTK089 (ColE1, AmpR); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35708612
Comments: Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning

Proper citation: RRID:Addgene_179072 Copy   


  • RRID:Addgene_182949

http://www.addgene.org/182949

Species: Rattus norvegicus
Genetic Insert: TRk-C-mCherry
Vector Backbone Description: Backbone Marker:Kinsella, T.M., and Nolan, G.P; Backbone Size:11652; Vector Backbone:LZRSpBMN-Z; Vector Types:Mammalian Expression, Retroviral, Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182949 Copy   


  • RRID:Addgene_182948

http://www.addgene.org/182948

Species: Rattus norvegicus
Genetic Insert: mVenus-TrkC
Vector Backbone Description: Backbone Marker:Kinsella, T. M., and Nolan, G. P; Backbone Size:11471; Vector Backbone:LZRSpBMN-Z; Vector Types:Mammalian Expression, Retroviral, Synthetic Biology; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_182948 Copy   


  • RRID:Addgene_185138

    This resource has 1+ mentions.

http://www.addgene.org/185138

Species: Rattus norvegicus
Genetic Insert: Lysosome-associated membrane glycoprotein 1
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please note that this plasmid will send mScarlet to the lumenal side of the lysosome (LAMP1 N terminus) so that it can be used for lysosomal pH sensing. This plasmid is described in a published paper that does not have a PubMed ID. Please cite as DOI: https://doi.org/10.5281/zenodo.6363342

Proper citation: RRID:Addgene_185138 Copy   


http://www.addgene.org/164478

Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:6900; Vector Backbone:pLenti; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33237838
Comments: Please note there is a single mutation in sfGFP-D117Y. Depositor confirms this is not a concern for plasmid function.

Proper citation: RRID:Addgene_164478 Copy   


  • RRID:Addgene_184669

http://www.addgene.org/184669

Species: Rattus norvegicus
Genetic Insert: LAMP1-miRFP670nano3
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35606446

Proper citation: RRID:Addgene_184669 Copy   


  • RRID:Addgene_186577

http://www.addgene.org/186577

Species: Rattus norvegicus
Genetic Insert: AP180
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35852853
Comments: Please note: The plasmid is difficult to sequence near bases 2140-2220 that are within the insert.

Proper citation: RRID:Addgene_186577 Copy   


  • RRID:Addgene_91780

http://www.addgene.org/91780

Species: Rattus norvegicus
Genetic Insert: GCaMP3-44
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28162809

Proper citation: RRID:Addgene_91780 Copy   


  • RRID:Addgene_91778

http://www.addgene.org/91778

Species: Rattus norvegicus
Genetic Insert: GCaMP6-210
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28162809

Proper citation: RRID:Addgene_91778 Copy   


http://www.addgene.org/92285

Species: Rattus norvegicus
Genetic Insert: rM3D
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28712653

Proper citation: RRID:Addgene_92285 Copy   


  • RRID:Addgene_92427

http://www.addgene.org/92427

Species: Rattus norvegicus
Genetic Insert: Stx4
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818

Proper citation: RRID:Addgene_92427 Copy   


  • RRID:Addgene_92428

http://www.addgene.org/92428

Species: Rattus norvegicus
Genetic Insert: Stx3
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818

Proper citation: RRID:Addgene_92428 Copy   


  • RRID:Addgene_92421

http://www.addgene.org/92421

Species: Rattus norvegicus
Genetic Insert: Stx3
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818

Proper citation: RRID:Addgene_92421 Copy   


  • RRID:Addgene_92422

    This resource has 1+ mentions.

http://www.addgene.org/92422

Species: Rattus norvegicus
Genetic Insert: Stx4
Vector Backbone Description: Backbone Marker:Van den Bogaart lab; Vector Backbone:pmCitrine-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28524818

Proper citation: RRID:Addgene_92422 Copy   


  • RRID:Addgene_186688

http://www.addgene.org/186688

Species: Rattus norvegicus
Genetic Insert: Synaptotagmin 2
Vector Backbone Description: Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35322233

Proper citation: RRID:Addgene_186688 Copy   


  • RRID:Addgene_187906

http://www.addgene.org/187906

Species: Rattus norvegicus
Genetic Insert: Fra1
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15618352

Proper citation: RRID:Addgene_187906 Copy   


  • RRID:Addgene_98705

http://www.addgene.org/98705

Species: Rattus norvegicus
Genetic Insert: Glt1a
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11896154
Comments: Please note that mutation I288V in Glt1a (reference AY069978) was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

Proper citation: RRID:Addgene_98705 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X