Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV2/5 Resource Report Resource Website 10+ mentions |
RRID:Addgene_104964 | Rep2/Cap5 | Other | Ampicillin | Contains the p5 promoter upstream of RepCap as well as the p5 promoter downstream of RepCap in the 3' orientation. This configuration of promoters has been shown to improve viral production yields. | Vector Backbone:pUC19 with additional elements; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 12:50:28 | 33 | ||
|
His-NavMs Resource Report Resource Website 1+ mentions |
RRID:Addgene_100004 | His-NavMs, Voltage gated sodium channel | Magnetococcus marinus | Ampicillin | PMID:28205548 | Note: The GFP variant in this plasmid is missing the last five amino acids compared to the closest reference sequence (AAC53663.1). The depositor has confirmed that this does not impact plasmid function. | Backbone Marker:Thermofisher; Backbone Size:6200; Vector Backbone:pTracer-CMV2, IRES GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C-terminus from a codon-optimized synthetic gene, starting at residue H237 | 2026-08-29 12:49:52 | 1 |
|
HA-HIF1α P402A/P564A/N803A-pcDNA3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_87261 | Hypoxia inducible factor 1 alpha | Homo sapiens | Ampicillin | PMID:17220275 | pcDNA3.0-HA-HIF1α P402A/P564A/N803A was made from pcDNA3.0-HA-HIF1α P402A/P564A ( Addgene (Plasmid #18955) using the QuikChange site-directed mutagenesis kit (Stratagene) | Backbone Marker:Invitrogen; Backbone Size:5433; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P402A/P564A/N803A | 2026-08-29 01:12:19 | 1 |
|
hu DNA-PKcs Resource Report Resource Website 1+ mentions |
RRID:Addgene_83317 | human DNA-PKcs | Homo sapiens | Ampicillin | PMID:16314509 | Backbone Size:4665; Vector Backbone:pcmv6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wild type | 2026-08-29 01:11:51 | 3 | |
|
mycBioID-pBABE-puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_80901 | Ampicillin | PMID:22412018 | Backbone Size:6213; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:11:19 | 4 | ||||
|
BAP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_81024 | BAP1 | Homo sapiens | Ampicillin | PMID:26095772 | Backbone Marker:Rao lab (Addgene plasmid# 17442); Backbone Size:8200; Vector Backbone:MSCV-IRES-Thy1.1 DEST; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:11:20 | 4 | ||
|
pBabe Puro osTIR1-9Myc Resource Report Resource Website 1+ mentions |
RRID:Addgene_80074 | OsTIR1 | Other | Ampicillin | PMID:29804665 | The osTIR1-9Myc was a kind gift from Masato Kanemaki (National Institute of Genetics, Mishima, Japan). | Backbone Size:5213; Vector Backbone:pBabe; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:11:13 | 8 | |
|
pBABE-H2BGFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_26790 | H2B-GFP | Homo sapiens | Ampicillin | PMID:20551166 | H2B-GFP was cloned from pBOS-H2B-GFP (BD Biosciences) into the pBABE retroviral vector. | Backbone Marker:Bob Weinberg, Addgene plasmid 1764; Backbone Size:5200; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:11 | 12 | |
|
pBABEpuro WT ATG3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_26926 | autophagy-related 3 (yeast) | Mus musculus | Ampicillin | PMID:20723759 | Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:12 | 1 | ||
|
pBABEhygroHigheGFPhTERT Resource Report Resource Website 1+ mentions |
RRID:Addgene_28169 | eGFPhTERT | Homo sapiens | Ampicillin | PMID:12198499 | Backbone Size:5500; Vector Backbone:pBABEhygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:03:27 | 5 | ||
|
mTert-pBabe-puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_36413 | mTERT | Mus musculus | Ampicillin | PMID:21732358 | Backbone Marker:Bob Weinberg (Addgene Plasmid #1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:32 | 5 | ||
|
pBabe hygro 3xFLAG Dna2 wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_31955 | hDna2 | Homo sapiens | Ampicillin | PMID:22570476 | to get 3XFLAG hDna2 out cut with BAMH1 and SAL1 | Backbone Size:5200; Vector Backbone:pBabe hygro 3xFLAG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Changed start ATG to AAA, | 2026-08-29 01:03:54 | 3 |
|
pBAD Strep His6 TEV LIC cloning vector (8HR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_37505 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through | Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:04:40 | 1 | ||||
|
pBabepuro-KIBRA Resource Report Resource Website 1+ mentions |
RRID:Addgene_40887 | KIBRA | Homo sapiens | Ampicillin | PMID:22614006 | Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:05:09 | 2 | ||
|
pBabe-HA-mMcl-1(T144D) Resource Report Resource Website 1+ mentions |
RRID:Addgene_25388 | mMCL1(T144D) | Mus musculus | Ampicillin | PMID:19433446 | Backbone Size:5169; Vector Backbone:pBabe IRES puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | P142T T144D | 2026-08-29 01:02:39 | 1 | |
|
pBabepuro-myc-ER Resource Report Resource Website 10+ mentions |
RRID:Addgene_19128 | c-myc | Homo sapiens | Ampicillin | PMID:15367674 | Please see Littlewood et al., Nucleic Acids Res. 1995 May 25;23(10):1686-90 for more information regarding the mutant hormone binding domain of the mouse estrogen receptor (hbER Tam). | Backbone Size:5169; Vector Backbone:pBabepuro3:hbER tam; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:01:41 | 16 | |
|
pBABE-hygro Resource Report Resource Website 10+ mentions |
RRID:Addgene_1765 | Ampicillin | PMID:2194165 | Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication: Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96. If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC. Please note that the sequence from which the Addgene map was generated is an estimate of the real sequence based on how the vector was assembled. We encourage scientists to test enzymes before using them for cloning. | Backbone Size:5558; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:00:47 | 36 | |||
|
pBABE-zeo (pBABE-bleo) Resource Report Resource Website 10+ mentions |
RRID:Addgene_1766 | Ampicillin | PMID:2194165 | Please acknowledge Jay Morgenstern and Hartmut Land and cite the following article if you use this plasmid in a publication: Morgenstern JP, Land H., 1990, Nucleic Acids Research 18(12):3587-96. SspI site in Amp gene. If you are using the pBABE protocol from the Weinberg Lab to generate virus, please note that the Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging. The pCL-Eco plasmid listed in their protocol should be substituted with pUMVC. | Backbone Size:4888; Vector Backbone:pBABE-zeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:00:48 | 12 | |||
|
pLenti-Ef1a-mClover-YTHDC1-T2A-BSD-siRNA-Resistant Resource Report Resource Website 1+ mentions |
RRID:Addgene_177129 | YTHDC1 | Homo sapiens | Ampicillin | PMID:34375583 | Vector Backbone:modified from Addgene 61425; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | siRNA resistant silent mutations | 2026-08-29 01:00:53 | 1 | |
|
pBABEpuro GFP-LC3 Resource Report Resource Website 50+ mentions |
RRID:Addgene_22405 | microtubule-associated protein 1 light chain 3 beta | Rattus norvegicus | Ampicillin | PMID:18094039 | LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Kabeya Y et al. (EMBO J. 2000 Nov 1. 19(21):5720-8. | Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:20 | 98 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
