Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCEV-G2-Km ymTurquoise2 Resource Report Resource Website |
RRID:Addgene_193958 | ymTurquoise2 | Synthetic | Ampicillin | Backbone Size:6900; Vector Backbone:pCEV-G2-KM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:38 | 0 | |||
|
lentiGuide-Puro.3xBsmBI Resource Report Resource Website 1+ mentions |
RRID:Addgene_196709 | Ampicillin | PMID:28993443 | Backbone Marker:Feng Zhang Lab; Vector Backbone:lentiGuide-Puro (#52963); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:38 | 6 | ||||
|
pLA2ScIfmTcIfm Resource Report Resource Website |
RRID:Addgene_193792 | Two copies of frame-shifted CI in opposite orientation, controlled by separate promoters and terminators | Bacteriophage lambda | Ampicillin | PMID:30867677 | Backbone Size:2200; Vector Backbone:pZ; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:39 | 0 | ||
|
pUS250 Resource Report Resource Website 1+ mentions |
RRID:Addgene_198322 | Kanamycin | CLONING: The multiple cloning site (MCS) in pUS250 functions differently to a typical MCS. You need to choose one unique restriction site on the left side of the amilCP marker gene (e.g. EcoRI), and one unique restriction site on the right side (e.g. PstI) in order for the blue/white selection and the cumate-inducible expression features to work properly. Cutting the plasmid in this way excises the amilCP gene, replacing it with your gene of interest, and changing the phenotype from blue to white. The vector is also compatible with GoldenGate cloning (using either BsaI or Esp3I) and BioBrick cloning (iGEM). In the case of GoldenGate cloning, you don't need to use two different enzymes, you just use one or the other, since each enzyme has two sites, one on each side of amilCP, and each yields a different overhang. HOST RANGE and EXPRESSION: we have shown that pUS250 can be used for cumate-inducible gene expression in E.coli, Pseudomonas putida, and Rhizobium leguminosarum. It is likely that the plasmid will also be useful in other gram negatives (Proteobacteria) since the pBBR replicon has a very broad host range. The plasmid can be transferred by conjugation from E.coli strains such as S17 or SM10 into other species due to the oriT sequence. For the E.coli and Rhizobium, 100 uM cumate is sufficient for expression. For Pseudomonas, this needs to be increased to 10 mM (we think there is an efflux pump that pumps cumate back out of these cells). The cumate should be added after autoclaving. We make a 0.5 M cumate stock solution by mixing equal parts of 1M aqueous Tris base with 1M cumic acid in ethanol. Cumate is an excellent inducer since it is both cheap and non-toxic to both bacteria and people. You can even use cumin (the spice) for induction of gene expression in this plasmid! (there is enough cumate in the cumin). STABILITY and COPY NUMBER: We estimate that the vector has a copy number of 5-10 in E.coli, so it is certainly a low copy vector. Best to make large-scale plasmid preps (e.g. 50 ml culture) rather than small-scale, in order to ensure you get enough plasmid DNA to work with. The plasmid is quite stable but we have seen white mutants appear occasionally which have deletions in amilCP. | Backbone Marker:Coleman; Backbone Size:4690; Vector Backbone:pUS250; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-12 02:37:39 | 2 | ||||
|
gZiPro W5F Resource Report Resource Website |
RRID:Addgene_198443 | glycine linked Zika virus NS2B-NS3 | Zika Virus (KJ776791.2) | Ampicillin | PMID:37379675 | Backbone Marker:MilliporeSigma (Novagen); Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | R95*A, W5F | 2026-09-12 02:37:39 | 0 | |
|
lenti.Cas9.BFP.sgRNA.parental Resource Report Resource Website |
RRID:Addgene_196715 | Ampicillin | Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:38 | 0 | |||||
|
lenti-UCOE-dCas9-BFP-Zim3-KRAB Resource Report Resource Website |
RRID:Addgene_196716 | dCas9-TagBFP-KRAB(ZIM3) | S. pyogenes | Ampicillin | Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | D10A, N863A | 2026-09-12 02:37:39 | 0 | ||
|
lenti-Cas9-sgHPRT1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_196713 | Cas9-T2A-BSD-U6-sgHPRT1 | S. pyogenes | Ampicillin | PMID:28993443 | Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:38 | 2 | ||
|
lenti-dCas9-ZIM3-KRAB-BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_196712 | dCas9-KRAB(ZIM3)-T2A-TagBFP | S. pyogenes | Ampicillin | Backbone Marker:Feng Zhang Lab; Vector Backbone:lenti dCas9-VP64_Blast (#61425); Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | D10A, N863A | 2026-09-12 02:37:38 | 1 | ||
|
pEF_PE2 Resource Report Resource Website |
RRID:Addgene_199267 | PE2-P2A-mp53DD | Mus musculus | Ampicillin | PMID:36302757 | Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Δ40-903 | 2026-09-12 02:37:39 | 0 | |
|
p-mCherry2-sgRNA (empty) Resource Report Resource Website 1+ mentions |
RRID:Addgene_198330 | U6-sgRNA(F+E) empty | Kanamycin | PMID:37063065 | Users should follow the oligo cloning protocol from the Zhang lab for plasmid lentiCRISPR v2 (Addgene #52961) to 1) remove stuffer fragment and 2) insert annealed oligos to complete gRNA. | Backbone Marker:Addgene 54563; Backbone Size:4722; Vector Backbone:mCherry2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:37:39 | 1 | ||
|
pCRISPRa_all-in-one Resource Report Resource Website |
RRID:Addgene_183695 | Ampicillin | PMID:35523806 | This plasmid also expresses MS2-p65-HSF1 activation domains as CRISPRa synergistic Activation Mediators (SAM) and mCherry | Vector Backbone:pEF1; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:39 | 0 | |||
|
pCRISPRa_CHO-Bip_gRNA1 Resource Report Resource Website |
RRID:Addgene_183694 | gRNA targeting chinese hamster Bip (Hspa5) | gRNA | Ampicillin | PMID:35523806 | This plasmid also expresses TagBFP | Vector Backbone:pPGK; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:39 | 0 | |
|
pET30_Halotag_K73T_v2 Resource Report Resource Website |
RRID:Addgene_183692 | ER Halo(K73T) | Bacterial | Kanamycin | PMID:35523806 | Vector Backbone:pET30; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | K73T in Halotag | 2026-09-12 02:37:39 | 0 | |
|
pCI_E01_mini-mAgrin-Myc-His-WPRE__LG3 Resource Report Resource Website |
RRID:Addgene_198140 | mini-Agrin | Mus musculus | Ampicillin | Backbone Marker:Promega; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-12 02:37:39 | 0 | |||
|
N-terminal 3X Flag Human CASP9 C287A Mutant Resource Report Resource Website |
RRID:Addgene_198380 | N-Terminal 3X Flag Human Caspase-9 C287A Mutant | Homo sapiens | Ampicillin | PMID:32397873 | Backbone Marker:Invitrogen; Backbone Size:4994; Vector Backbone:pCR3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Cysteine 287 to Alanine to eliminate protease activity | 2026-09-12 02:37:39 | 0 | |
|
P1_Firre_1.49_pDONR221 Resource Report Resource Website |
RRID:Addgene_195204 | mFirre 1.49 Clone | Mus musculus | Kanamycin | PMID:24463464 | Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning Intermediate; Bacterial Resistance:Kanamycin | Only exons | 2026-09-12 02:37:39 | 0 | |
|
pMUT2-pLac-mCherry Resource Report Resource Website |
RRID:Addgene_192859 | lldR operon | Escherichia coli | Kanamycin | PMID:36449712 | Backbone Size:4866; Vector Backbone:pMUT2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:37:39 | 0 | ||
|
pMUT2-pAto-mCherry Resource Report Resource Website |
RRID:Addgene_192858 | Acetoacetate inducible promoter | Escherichia coli | Kanamycin | PMID:36449712 | Backbone Size:5591; Vector Backbone:pMUT2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:37:39 | 0 | ||
|
p-mCherry2-sgMUC4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_198399 | MUC4 sgRNA | Homo sapiens | Kanamycin | PMID:37063065 | MUC4 guide sequence used is from Chen et al., 2013 (/doi.org/10.1016/j.cell.2013.12.001), where it is referred to as MUC4-E3. Target sequence: GGCGTGACCTGTGGATGCTG | Backbone Marker:Addgene 198330; Backbone Size:5258; Vector Backbone:pmCherry-sgRNA (empty); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-12 02:37:39 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
