Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pNM3811 Resource Report Resource Website |
RRID:Addgene_154120 | mec-4p::QF2::act-4 '3 | Caenorhabditis elegans | Ampicillin | PMID:32513816 | Backbone Marker:Addgene #153083; Backbone Size:7855; Vector Backbone:pLF3FShC; Vector Types:Worm Expression, RMCE; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:53 | 0 | ||
|
pJG103 Resource Report Resource Website |
RRID:Addgene_158533 | wrmScarlet11 x3 tandem repeats | Caenorhabditis elegans | Kanamycin | PMID:33693628 | Please visit https://www.biorxiv.org/content/10.1101/2020.07.02.185249v1 for bioRxiv preprint. | Backbone Marker:Genewiz; Backbone Size:2626; Vector Backbone:pUC57-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:25:06 | 0 | |
|
pAS18 Resource Report Resource Website |
RRID:Addgene_158787 | Ptag-168::GCaMP6m::rpl-1a | Caenorhabditis elegans | Ampicillin | PMID:32574560 | Backbone Marker:C.I. Bargmann and S. MaCarroll; Vector Backbone:pSM; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:25:11 | 0 | ||
|
pHCMM4 Resource Report Resource Website |
RRID:Addgene_170359 | PCYC1_SEC61_mCherry_LEU2_TCYC1 | Caenorhabditis elegans | Ampicillin | PMID:32907940 | Backbone Size:4872; Vector Backbone:NA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:28:16 | 0 | ||
|
pAAP20 Resource Report Resource Website |
RRID:Addgene_171206 | meg-3 | Caenorhabditis elegans | Kanamycin | Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint. | Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | aa545-862 | 2026-09-01 09:28:30 | 0 | |
|
pHS33 Resource Report Resource Website |
RRID:Addgene_171202 | meg-3 | Caenorhabditis elegans | Ampicillin | Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint. | Vector Backbone:pGEX-6p-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa545-862, F705A,Y708A,Y713A, N725A | 2026-09-01 09:28:30 | 0 | |
|
pJW4.04 Resource Report Resource Website |
RRID:Addgene_171209 | pgl-3 | Caenorhabditis elegans | Ampicillin | Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint. | Vector Backbone:pMAL-c2X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:28:30 | 0 | ||
|
pJK2020 Resource Report Resource Website |
RRID:Addgene_171932 | Pmex-5::MS2 Coat Protein::linker::sfGFP::tbb-2 3'UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3'UTR | Caenorhabditis elegans | Ampicillin | PMID:31378588 | Vector Backbone:pCFJ151; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:28:42 | 0 | ||
|
pJK2014 Resource Report Resource Website |
RRID:Addgene_171931 | Psygl-1::24XMS2 loops::3X Flag::sygl-1 ORF::sygl-1 3'UTR | Caenorhabditis elegans | Ampicillin | PMID:31378588 | Vector Backbone:pCFJ151; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:28:42 | 0 | ||
|
pDD283 Resource Report Resource Website 1+ mentions |
RRID:Addgene_66824 | YPET-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:26044593 | IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined. | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:59:48 | 3 | |
|
pDD282 Resource Report Resource Website 50+ mentions |
RRID:Addgene_66823 | GFP-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:26044593 | IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined. Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat] | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:59:48 | 51 | |
|
pClneoEGFPC RSF-1 Resource Report Resource Website |
RRID:Addgene_66862 | RSF-1 | Caenorhabditis elegans | Ampicillin | PMID:23103556 | Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S18G, S229T, I403T and F563S mutations in RSF-1 compared to GenBank reference sequence NP_001022361.1 | 2026-09-01 09:59:48 | 0 | |
|
pClneoFH-let60 G12V Resource Report Resource Website 1+ mentions |
RRID:Addgene_66860 | Let-60 | Caenorhabditis elegans | Ampicillin | PMID:23103556 | Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Glycine 12 is mutated to valine | 2026-09-01 09:59:48 | 1 | |
|
pPD95.75-cYAP-1 Resource Report Resource Website |
RRID:Addgene_66857 | C.elegans YAP-1 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | I performed PCR on C.elegans genome to isolate the genome of YAP-1 which contain 5' UTR and the coding exons and introns. I subcloned the product into PstI/SmaI sites of PD95.75, so that GFP is fused to the last exon. Serine 104 was mutated to alanine. | Backbone Marker:Addgene; Vector Backbone:PD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | Serine104 is mutated to alanine | 2026-09-01 09:59:48 | 0 |
|
pClneoMyc'-EGL-44 Resource Report Resource Website |
RRID:Addgene_66855 | EGL-44 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:59:48 | 0 | ||
|
pFLAG-WTS-1 Resource Report Resource Website |
RRID:Addgene_66856 | WTS-1 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | Backbone Marker:Eastman Kodak Company; Backbone Size:4700; Vector Backbone:pFLAG-CMV-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E153G and D871G mutations in WTS1 compared to GenBank reference sequence NP_492699.1 | 2026-09-01 09:59:48 | 0 | |
|
pKPY737 Resource Report Resource Website |
RRID:Addgene_72673 | Thr412Gly-CePheRS Alpha Subunit::C. elegans CEOP5428 Intercistronic Region::HA-GFP [From pPD95.75 (+118 to +1000)] in pDONR221 | Caenorhabditis elegans | Kanamycin | Note: the first methionine in the alpha subunit of C. elegans PheRS, Isoform A, Exon 3 is designated as residue 1 (“Met1”). | Backbone Marker:Invitrogen; Backbone Size:2544; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Thr412Gly in CePheRS Alpha Subunit | 2026-09-01 10:01:04 | 0 | |
|
pKPY738 Resource Report Resource Website |
RRID:Addgene_72674 | let-858 3' UTR [From pPD129.57 (+2554 to +2960)] in pDONR P2R-P3 | Caenorhabditis elegans | Kanamycin | Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-09-01 10:01:04 | 0 | |||
|
pDD315 (mTurquoise2^SEC^2xHA) Resource Report Resource Website 1+ mentions |
RRID:Addgene_73343 | mTurquoise2-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:37351566 | pDD315 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015). It has a 2xHA tag in place of 3xFlag, and Lox511I sites in place of LoxP. These features allow pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between epitope tags and Lox sites. | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 10:01:13 | 2 | |
|
pDD317 (Pmyo-2::GFP + SEC) Resource Report Resource Website |
RRID:Addgene_73344 | Pmyo-2::GFP + SEC | Caenorhabditis elegans | Ampicillin | PMID:34903234 | pDD317 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015) and is intended for making gene knockouts. It has a Pmyo-2::GFP expression cassette (bright pharyngeal fluorescence) in place of the simple fluorescent protein found in our other FP–SEC vectors. Pmyo-2::GFP + SEC is intended to be inserted in place of an entire ORF such that after insertion and SEC removal, the knockout is marked with Pmyo-2::GFP. The vector also has Lox511I sites in place of LoxP, allowing pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between Lox sites. | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 10:01:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
