Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: mec-4p::QF2::act-4 '3
Vector Backbone Description: Backbone Marker:Addgene #153083; Backbone Size:7855; Vector Backbone:pLF3FShC; Vector Types:Worm Expression, RMCE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32513816
Proper citation: RRID:Addgene_154120 Copy
Species: Caenorhabditis elegans
Genetic Insert: wrmScarlet11 x3 tandem repeats
Vector Backbone Description: Backbone Marker:Genewiz; Backbone Size:2626; Vector Backbone:pUC57-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33693628
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.07.02.185249v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_158533 Copy
Species: Caenorhabditis elegans
Genetic Insert: Ptag-168::GCaMP6m::rpl-1a
Vector Backbone Description: Backbone Marker:C.I. Bargmann and S. MaCarroll; Vector Backbone:pSM; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32574560
Proper citation: RRID:Addgene_158787 Copy
Species: Caenorhabditis elegans
Genetic Insert: PCYC1_SEC61_mCherry_LEU2_TCYC1
Vector Backbone Description: Backbone Size:4872; Vector Backbone:NA; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32907940
Proper citation: RRID:Addgene_170359 Copy
Species: Caenorhabditis elegans
Genetic Insert: meg-3
Vector Backbone Description: Vector Backbone:pet28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_171206 Copy
Species: Caenorhabditis elegans
Genetic Insert: meg-3
Vector Backbone Description: Vector Backbone:pGEX-6p-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_171202 Copy
Species: Caenorhabditis elegans
Genetic Insert: pgl-3
Vector Backbone Description: Vector Backbone:pMAL-c2X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.10.15.340570v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_171209 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmex-5::MS2 Coat Protein::linker::sfGFP::tbb-2 3'UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3'UTR
Vector Backbone Description: Vector Backbone:pCFJ151; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31378588
Proper citation: RRID:Addgene_171932 Copy
Species: Caenorhabditis elegans
Genetic Insert: Psygl-1::24XMS2 loops::3X Flag::sygl-1 ORF::sygl-1 3'UTR
Vector Backbone Description: Vector Backbone:pCFJ151; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31378588
Proper citation: RRID:Addgene_171931 Copy
Species: Caenorhabditis elegans
Genetic Insert: YPET-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Proper citation: RRID:Addgene_66824 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]
Proper citation: RRID:Addgene_66823 Copy
Species: Caenorhabditis elegans
Genetic Insert: RSF-1
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66862 Copy
Species: Caenorhabditis elegans
Genetic Insert: Let-60
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66860 Copy
Species: Caenorhabditis elegans
Genetic Insert: C.elegans YAP-1
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:PD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Comments: I performed PCR on C.elegans genome to isolate the genome of YAP-1 which contain 5' UTR and the coding exons and introns. I subcloned the product into PstI/SmaI sites of PD95.75, so that GFP is fused to the last exon. Serine 104 was mutated to alanine.
Proper citation: RRID:Addgene_66857 Copy
Species: Caenorhabditis elegans
Genetic Insert: EGL-44
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66855 Copy
Species: Caenorhabditis elegans
Genetic Insert: WTS-1
Vector Backbone Description: Backbone Marker:Eastman Kodak Company; Backbone Size:4700; Vector Backbone:pFLAG-CMV-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66856 Copy
Species: Caenorhabditis elegans
Genetic Insert: Thr412Gly-CePheRS Alpha Subunit::C. elegans CEOP5428 Intercistronic Region::HA-GFP [From pPD95.75 (+118 to +1000)] in pDONR221
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2544; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Note: the first methionine in the alpha subunit of C. elegans PheRS, Isoform A, Exon 3 is designated as residue 1 (“Met1”).
Proper citation: RRID:Addgene_72673 Copy
Species: Caenorhabditis elegans
Genetic Insert: let-858 3' UTR [From pPD129.57 (+2554 to +2960)] in pDONR P2R-P3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_72674 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTurquoise2-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37351566
Comments: pDD315 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015). It has a 2xHA tag in place of 3xFlag, and Lox511I sites in place of LoxP. These features allow pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between epitope tags and Lox sites.
Proper citation: RRID:Addgene_73343 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pmyo-2::GFP + SEC
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34903234
Comments: pDD317 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015) and is intended for making gene knockouts. It has a Pmyo-2::GFP expression cassette (bright pharyngeal fluorescence) in place of the simple fluorescent protein found in our other FP–SEC vectors. Pmyo-2::GFP + SEC is intended to be inserted in place of an entire ORF such that after insertion and SEC removal, the knockout is marked with Pmyo-2::GFP. The vector also has Lox511I sites in place of LoxP, allowing pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between Lox sites.
Proper citation: RRID:Addgene_73344 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
