Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

742,581 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pET28a_6HT-TBP6.7(Q54A)
 
Resource Report
Resource Website 		RRID:Addgene_112730 6His-TEV-TBP6.7(Q54A) Other Kanamycin PMID:29961805 Backbone Size:5277; Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Q54A 2026-09-12 02:15:25 0
pAAV Gsk3 sgRNA/GFP
 
Resource Report
Resource Website 		RRID:Addgene_112733 GFP Mus musculus Ampicillin PMID:29706865 gRNA targeting mouse Gsk3b gene was cloned into the plasmid PX552 received from Dr. Feng Zhang. Backbone Marker:Feng Zhang; Backbone Size:4574; Vector Backbone:PX552; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin 2026-09-12 02:15:25 0
pET-2(KW)2-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_112738 2(KW)2-mCherry E. coli Ampicillin PMID:26264666 Note: The mCherry insert contains a N9Q mutation. The depositor has confirmed this does not affect plasmid function. Backbone Marker:Novagen; Backbone Size:5706; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:25 0
pET-2HMG-eGFP
 
Resource Report
Resource Website 		RRID:Addgene_112737 2HMG-eGFP E. coli Ampicillin Backbone Marker:Novagen; Backbone Size:5706; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:25 0
pET28a_6HT-TBP6.7(WT)
 
Resource Report
Resource Website 		RRID:Addgene_112720 6His-TEV-TBP6.7(WT) Other Kanamycin PMID:29961805 Backbone Size:5277; Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:15:24 0
pET28a_6HT-TBP6.7(R47A)
 
Resource Report
Resource Website 		RRID:Addgene_112722 6His-TEV-TBP6.7(R47A) Other Kanamycin PMID:29961805 Backbone Size:5277; Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin R47A 2026-09-12 02:15:24 0
pET28a_6HT-TBP6.7(R49A)
 
Resource Report
Resource Website 		RRID:Addgene_112726 6His-TEV-TBP6.7(R49A) Other Kanamycin PMID:29961805 Backbone Size:5277; Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin R49A 2026-09-12 02:15:24 0
His6-SUMO-pET28a-EfaCas1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112793 EfaCas1 Synthetic Kanamycin PMID:28869593 Backbone Size:5800; Vector Backbone:His6-SUMO-pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-12 02:15:25 1
pTU2-AmyE-Pveg-eGFP
 
Resource Report
Resource Website 		RRID:Addgene_112792 Pveg-eGFP Synthetic Chloramphenicol Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint. Backbone Marker:iGEM; Backbone Size:3185; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-09-12 02:15:25 0
pTU1-C-cat
 
Resource Report
Resource Website 		RRID:Addgene_112791 cat Synthetic Ampicillin Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint. Backbone Marker:iGEM; Backbone Size:2532; Vector Backbone:pSB1A2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:25 0
pTU1-D-yckABD
 
Resource Report
Resource Website 		RRID:Addgene_112790 yckABD Synthetic Ampicillin Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint. Backbone Marker:iGEM; Backbone Size:2532; Vector Backbone:pSB1A2 ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:25 0
pGMV-U
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112797 Kanamycin Addgene NGS results identified an IS5 element immediately upstream of KanR, which should not affect plasmid function. Backbone Size:15615; Vector Backbone:pTC223; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-09-12 02:15:25 2
pcDNA4/TO-bio-myc-NES-EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112712 EGFP Aequorea victoria Ampicillin PMID:30166341 The N-terminal tag sequence of this insert is exactly the same as in pcDNA4/TO-bio-myc-cCE, thus providing a specificity control for pulldown assays. Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Nucleotide sequence optimized for synthetic gene production 2026-09-12 02:15:24 1
pcDNA4/TO-bio-myc-cCE
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112711 Rngtt Mus musculus Ampicillin PMID:30166341 For more information about this plasmid, see Mukherjee et al. 2014 PLoS Biol (10.1371/journal.pbio.1001933). The insert sequence of this plasmid was subcloned from pcDNA3-bio-myc-NES-mCEΔNLS described in this publication. Additional internal sequencing primers: IntCE1-F: GAATGCCCCACCACTGAGAATACTG IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Silent mutation at Arg 132 (CGT to CGC), deleted amino acids 573-576 (KRKY nuclear localization signal) 2026-09-12 02:15:24 1
p3 FLAG_CMV14/OCTN2 (wt)
 
Resource Report
Resource Website 		RRID:Addgene_112799 OCTN2/SLC22A5 Rattus norvegicus Ampicillin PMID:24349196 Backbone Marker:Sigma; Vector Backbone:p3 FLAG_CMV14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:25 0
pET28b-His-hCE
 
Resource Report
Resource Website 		RRID:Addgene_112710 RNGTT Homo sapiens Kanamycin PMID:28981715 Backbone Marker:Novagen; Backbone Size:5368; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin R594H 2026-09-12 02:15:24 0
pcDNA3.1-CFP-KRAS4B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112717 CFP-KRAS4B Homo sapiens Ampicillin PMID:29336889 Backbone Marker:ThermoFisher Scientific; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:24 2
pcDNA3-bio-myc-mCE 211-597
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112716 Rngtt Mus musculus Ampicillin PMID:30166341 This plasmid encodes the guanylyltransferase domain of RNGTT. Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 2-210 (triphosphatase domain) 2026-09-12 02:15:24 1
pcDNA3-bio-myc-mCE 2-210
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112715 Rngtt Mus musculus Ampicillin PMID:30166341 This plasmid encodes the triphosphatase domain of RNGTT. Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Silent mutation at Arg 132 (CGT to CGC), deleted amino acids 211-597 (guanylyltransferase domain) 2026-09-12 02:15:24 1
pcDNA3.1-YFP-KRAS4B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_112718 YFP-KRAS4B Homo sapiens Ampicillin PMID:29336889 Backbone Marker:ThermoFisher Scientific; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:15:24 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch