Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 66 showing 1301 ~ 1320 out of 1,970 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_103739

http://www.addgene.org/103739

Species: Homo sapiens
Genetic Insert: hsa-miR-873-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103739 Copy   


  • RRID:Addgene_103738

http://www.addgene.org/103738

Species: Homo sapiens
Genetic Insert: hsa-miR-873-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103738 Copy   


  • RRID:Addgene_103734

http://www.addgene.org/103734

Species: Homo sapiens
Genetic Insert: hsa-miR-767-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103734 Copy   


  • RRID:Addgene_103730

http://www.addgene.org/103730

Species: Homo sapiens
Genetic Insert: hsa-miR-765 target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103730 Copy   


  • RRID:Addgene_103733

http://www.addgene.org/103733

Species: Homo sapiens
Genetic Insert: hsa-miR-767-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103733 Copy   


  • RRID:Addgene_103732

http://www.addgene.org/103732

Species: Homo sapiens
Genetic Insert: hsa-miR-766-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103732 Copy   


  • RRID:Addgene_103746

http://www.addgene.org/103746

Species: Homo sapiens
Genetic Insert: hsa-miR-887-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103746 Copy   


  • RRID:Addgene_103744

http://www.addgene.org/103744

Species: Homo sapiens
Genetic Insert: hsa-miR-885-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103744 Copy   


  • RRID:Addgene_103724

http://www.addgene.org/103724

Species: Homo sapiens
Genetic Insert: hsa-miR-708-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103724 Copy   


  • RRID:Addgene_103723

http://www.addgene.org/103723

Species: Homo sapiens
Genetic Insert: hsa-miR-7-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103723 Copy   


  • RRID:Addgene_31231

    This resource has 1+ mentions.

http://www.addgene.org/31231

Species: Mustela putorius furo
Genetic Insert: GAD2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3950; Vector Backbone:pCRII-TOPO; Vector Types:cDNA for in situ hybridization; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:20575059
Comments: For riboprobe cut with EcoRI. Runoffs with SP6.

Proper citation: RRID:Addgene_31231 Copy   


  • RRID:Addgene_39249

http://www.addgene.org/39249

Genetic Insert: RAJ21 system
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707

Proper citation: RRID:Addgene_39249 Copy   


  • RRID:Addgene_39244

    This resource has 1+ mentions.

http://www.addgene.org/39244

Genetic Insert: RAJ11 system
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707

Proper citation: RRID:Addgene_39244 Copy   


  • RRID:Addgene_39250

http://www.addgene.org/39250

Genetic Insert: RAJ21 system (no transRNA)
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707

Proper citation: RRID:Addgene_39250 Copy   


  • RRID:Addgene_39254

http://www.addgene.org/39254

Genetic Insert: RAJ23 system (no transRNA)
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707

Proper citation: RRID:Addgene_39254 Copy   


http://www.addgene.org/32229

Genetic Insert: TAP tag
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:TOPO; Vector Types:Cloning; Bacterial Resistance:Ampicillin and Kanamycin
Comments: The TAP tag consists of calmodulin binding peptide (CBP) from the N-terminal, followed by tobacco etch virus protease (TEV protease) cleavage site and Protein A, which binds tightly to IgG.

Proper citation: RRID:Addgene_32229 Copy   


  • RRID:Addgene_32320

http://www.addgene.org/32320

Genetic Insert: GAL4 Kan
Vector Backbone Description: Vector Backbone:pBSC5; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21857163
Comments: Please see http://www.everyvector.com/sequences/show_public/12078 for additional plasmid map.

Proper citation: RRID:Addgene_32320 Copy   


  • RRID:Addgene_32435

http://www.addgene.org/32435

Genetic Insert: ECFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR2.1 TOPO; Vector Types:Cloning; Bacterial Resistance:Ampicillin and Kanamycin
Comments: For the addition of ECFP to the C-terminus of another cDNA by cloning the cDNA into the BamHI site (of the original pCR2.1 TOPO).

Proper citation: RRID:Addgene_32435 Copy   


  • RRID:Addgene_41017

    This resource has 1+ mentions.

http://www.addgene.org/41017

Genetic Insert: Kana_I-SceI
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:16526409

Proper citation: RRID:Addgene_41017 Copy   


  • RRID:Addgene_41064

http://www.addgene.org/41064

Vector Backbone Description: Backbone Size:4290; Vector Backbone:pTKIP; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:20047970

Proper citation: RRID:Addgene_41064 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X