Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 66 showing 1301 ~ 1320 out of 1,970 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_103738

http://www.addgene.org/103738

Species: Homo sapiens
Genetic Insert: hsa-miR-873-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103738 Copy   


  • RRID:Addgene_103734

http://www.addgene.org/103734

Species: Homo sapiens
Genetic Insert: hsa-miR-767-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103734 Copy   


  • RRID:Addgene_103730

http://www.addgene.org/103730

Species: Homo sapiens
Genetic Insert: hsa-miR-765 target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103730 Copy   


  • RRID:Addgene_103733

http://www.addgene.org/103733

Species: Homo sapiens
Genetic Insert: hsa-miR-767-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103733 Copy   


  • RRID:Addgene_103732

http://www.addgene.org/103732

Species: Homo sapiens
Genetic Insert: hsa-miR-766-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103732 Copy   


  • RRID:Addgene_103746

http://www.addgene.org/103746

Species: Homo sapiens
Genetic Insert: hsa-miR-887-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103746 Copy   


  • RRID:Addgene_103744

http://www.addgene.org/103744

Species: Homo sapiens
Genetic Insert: hsa-miR-885-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103744 Copy   


http://www.addgene.org/107307

Species: Other
Genetic Insert: CAG-LSL-dCas9-10xGCN4-P2A-scFv-P65-HSF1-T2A-EGFP-WPRE-PolyA
Vector Backbone Description: Vector Backbone:PB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29335603

Proper citation: RRID:Addgene_107307 Copy   


  • RRID:Addgene_176232

http://www.addgene.org/176232

Genetic Insert: cI of phage lambda, hok of the R1 plasmid, neo, hybrid PA1O4 promoter
Vector Backbone Description: Vector Backbone:pMW118; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35920321

Proper citation: RRID:Addgene_176232 Copy   


  • RRID:Addgene_176231

http://www.addgene.org/176231

Genetic Insert: cI of phage lambda, hok of the R1 plasmid, neo, truncated PH207 promoter of T5 phage
Vector Backbone Description: Vector Backbone:pMW118; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35920321

Proper citation: RRID:Addgene_176231 Copy   


  • RRID:Addgene_176233

http://www.addgene.org/176233

Genetic Insert: cI of phage lambda, hok of the R1 plasmid, neo, hybrid PA1O4 promoter
Vector Backbone Description: Vector Backbone:pMW118; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35920321

Proper citation: RRID:Addgene_176233 Copy   


  • RRID:Addgene_176230

http://www.addgene.org/176230

Genetic Insert: cI of phage lambda, hok of the R1 plasmid, neo, truncated PH207 promoter of T5 phage
Vector Backbone Description: Vector Backbone:pMW118; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35920321

Proper citation: RRID:Addgene_176230 Copy   


  • RRID:Addgene_176227

http://www.addgene.org/176227

Genetic Insert: cI of phage lambda, hok of the R1 plasmid, neo
Vector Backbone Description: Vector Backbone:pMW118; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35920321

Proper citation: RRID:Addgene_176227 Copy   


  • RRID:Addgene_176339

http://www.addgene.org/176339

Species: Homo sapiens
Genetic Insert: STAT5B
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562 cells. Our lab normally uses Top10 cells for transformation.

Proper citation: RRID:Addgene_176339 Copy   


  • RRID:Addgene_176353

http://www.addgene.org/176353

Species: Homo sapiens
Genetic Insert: HDX
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: WTC11 cells. Our lab normally uses Top10 cells for transformation.

Proper citation: RRID:Addgene_176353 Copy   


  • RRID:Addgene_176354

http://www.addgene.org/176354

Species: Homo sapiens
Genetic Insert: RORB
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: WTC11 cells. Our lab normally uses Top10 cells for transformation.

Proper citation: RRID:Addgene_176354 Copy   


  • RRID:Addgene_176349

http://www.addgene.org/176349

Species: Homo sapiens
Genetic Insert: ZNF22
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562 cells. Our lab normally uses Top10 cells for transformation.

Proper citation: RRID:Addgene_176349 Copy   


  • RRID:Addgene_176341

http://www.addgene.org/176341

Species: Homo sapiens
Genetic Insert: SNAPC5
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562 cells. Our lab normally uses Top10 cells for transformation.

Proper citation: RRID:Addgene_176341 Copy   


  • RRID:Addgene_176344

http://www.addgene.org/176344

Species: Homo sapiens
Genetic Insert: ZBED9
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562 cells. Our lab normally uses Top10 cells for transformation.

Proper citation: RRID:Addgene_176344 Copy   


  • RRID:Addgene_176347

http://www.addgene.org/176347

Species: Homo sapiens
Genetic Insert: CHCHD3
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Cloning source: K562 cells. Our lab normally uses Top10 cells for transformation.

Proper citation: RRID:Addgene_176347 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X