Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 64 showing 1261 ~ 1280 out of 4,489 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_160935

http://www.addgene.org/160935

Species: Saccharomyces cerevisiae
Genetic Insert: MCP-mCherry-HIS tag, 3'UTR MS2 Stem Loop
Vector Backbone Description: Backbone Size:6000; Vector Backbone:plIVMD156; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33037152

Proper citation: RRID:Addgene_160935 Copy   

    • RRID:Addgene_160936

http://www.addgene.org/160936

Species: Saccharomyces cerevisiae
Genetic Insert: MCP-sfGFP-HIS tag, 3'UTR MS2 Stem Loop
Vector Backbone Description: Backbone Size:6000; Vector Backbone:plIVMD156; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33037152
Comments: Please note that the T247A mutation in sfGFP does not impact plasmid function.

Proper citation: RRID:Addgene_160936 Copy   

    • RRID:Addgene_160939

http://www.addgene.org/160939

Species: Saccharomyces cerevisiae
Genetic Insert: MCP-mTagBFP2-HA Tag
Vector Backbone Description: Vector Backbone:psh100; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33037152

Proper citation: RRID:Addgene_160939 Copy   

    • RRID:Addgene_160930

http://www.addgene.org/160930

Species: Saccharomyces cerevisiae
Genetic Insert: HHF1
Vector Backbone Description: Backbone Marker:Berkeley Macrolab; Backbone Size:4786; Vector Backbone:pET (https://www.addgene.org/29666/); Vector Types:; Bacterial Resistance:Ampicillin
Comments: This is an improved version of the plasmid reported here: https://www.sciencedirect.com/science/article/abs/pii/S096921261930440X https://doi.org/10.1016/j.str.2019.12.002 All histone genes code for S. cerevisiae proteins. Expression and purification procedures are as described.

Proper citation: RRID:Addgene_160930 Copy   

    • RRID:Addgene_160929

http://www.addgene.org/160929

Species: Saccharomyces cerevisiae
Genetic Insert: HHF1
Vector Backbone Description: Backbone Marker:Berkeley Macrolab; Backbone Size:4786; Vector Backbone:pET (https://www.addgene.org/29666/); Vector Types:; Bacterial Resistance:Ampicillin
Comments: This is an improved version of the plasmid reported here: https://www.sciencedirect.com/science/article/abs/pii/S096921261930440X https://doi.org/10.1016/j.str.2019.12.002 All histone genes code for S. cerevisiae proteins.

Proper citation: RRID:Addgene_160929 Copy   

    • RRID:Addgene_160990

http://www.addgene.org/160990

Species: Saccharomyces cerevisiae
Genetic Insert: pol1
Vector Backbone Description: Vector Backbone:pGST-parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32923642

Proper citation: RRID:Addgene_160990 Copy   

    • RRID:Addgene_160988

http://www.addgene.org/160988

Species: Saccharomyces cerevisiae
Genetic Insert: pol1
Vector Backbone Description: Vector Backbone:pGST-parallel; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32923642

Proper citation: RRID:Addgene_160988 Copy   

http://www.addgene.org/161769

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA library targeting yeast genes
Vector Backbone Description: Backbone Marker:Addgene 35452; Vector Backbone:pRS41x; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33757429

Proper citation: RRID:Addgene_161769 Copy   

http://www.addgene.org/37101

Species: Saccharomyces cerevisiae
Genetic Insert: COF1-RFP
Vector Backbone Description: Vector Backbone:pRS413-HIS,Amp; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20332110

Proper citation: RRID:Addgene_37101 Copy   

    • RRID:Addgene_37228

http://www.addgene.org/37228

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37228 Copy   

    • RRID:Addgene_37229

http://www.addgene.org/37229

Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37229 Copy   

    • RRID:Addgene_37221

http://www.addgene.org/37221

Species: Saccharomyces cerevisiae
Genetic Insert: eIF5B
Vector Backbone Description: Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37221 Copy   

    • RRID:Addgene_37222

http://www.addgene.org/37222

Species: Saccharomyces cerevisiae
Genetic Insert: HHtRNA
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Comments: HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG

Proper citation: RRID:Addgene_37222 Copy   

    • RRID:Addgene_37217

http://www.addgene.org/37217

Species: Saccharomyces cerevisiae
Genetic Insert: eIF1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37217 Copy   

    • RRID:Addgene_37219

http://www.addgene.org/37219

Species: Saccharomyces cerevisiae
Genetic Insert: eIF5
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637

Proper citation: RRID:Addgene_37219 Copy   

    • RRID:Addgene_37233

http://www.addgene.org/37233

Species: Saccharomyces cerevisiae
Genetic Insert: HRC1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040

Proper citation: RRID:Addgene_37233 Copy   

http://www.addgene.org/37554

Species: Saccharomyces cerevisiae
Genetic Insert: Met3p-mCherry-Tub1
Vector Backbone Description: Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21294277

Proper citation: RRID:Addgene_37554 Copy   

    • RRID:Addgene_37557

http://www.addgene.org/37557

Species: Saccharomyces cerevisiae
Genetic Insert: Ras2 C-term (last 9 aa)
Vector Backbone Description: Backbone Size:4749; Vector Backbone:pKT0128; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19755860

Proper citation: RRID:Addgene_37557 Copy   

    • RRID:Addgene_37548

http://www.addgene.org/37548

Species: Saccharomyces cerevisiae
Genetic Insert: tandem PA-GFP
Vector Backbone Description: Backbone Size:4882; Vector Backbone:pDH3; Vector Types:Yeast tagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18727145

Proper citation: RRID:Addgene_37548 Copy   

    • RRID:Addgene_38228

http://www.addgene.org/38228

Species: Saccharomyces cerevisiae
Genetic Insert: HIS3
Vector Backbone Description: Backbone Size:6614; Vector Backbone:pCENBEVY-U; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24357599

Proper citation: RRID:Addgene_38228 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch