Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGC249 Resource Report Resource Website |
RRID:Addgene_19676 |
Gateway(R4-R3) |
Caenorhabditis elegans | Chloramphenicol and Ampicillin | PMID:18723890 | Sequence mismatches between Addgene sequence and depositor sequence do not affect function. | Backbone Size:0; Vector Backbone:pGC231; Vector Types:Worm Expression, FLP/FRT, destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:10 | 0 | |
|
pGC236 Resource Report Resource Website |
RRID:Addgene_19675 |
Gateway(R1-R2) |
Caenorhabditis elegans | Chloramphenicol and Ampicillin | PMID:18723890 | Backbone Size:0; Vector Backbone:pGC231; Vector Types:Worm Expression, FLP/FRT, destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:10 | 0 | ||
|
pGC31 Resource Report Resource Website |
RRID:Addgene_19678 | Gateway(R1-R2)-L4440 | Caenorhabditis elegans | Chloramphenicol and Ampicillin | PMID:18723890 | Backbone Size:0; Vector Backbone:L4440; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:11 | 0 | ||
|
pGC319 Resource Report Resource Website |
RRID:Addgene_19677 |
Gateway(R4-R3) |
Caenorhabditis elegans | Chloramphenicol and Ampicillin | PMID:18723890 | Backbone Size:0; Vector Backbone:pGC249; Vector Types:Worm Expression, FLP/FRT, destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:10 | 0 | ||
|
pgLAP1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_19702 | Chloramphenicol and Ampicillin | Backbone Marker:Invitrogen; Backbone Size:7624; Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:15 | 11 | |||||
|
pgLAP3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_19704 | pgLAP3 | Chloramphenicol and Ampicillin | Backbone Marker:Invitrogen; Backbone Size:8325; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:16 | 3 | ||||
|
pgLAP5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_19706 | pgLAP5 | Chloramphenicol and Ampicillin | Backbone Size:8365; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:16 | 8 | ||||
|
pgLAP4 Resource Report Resource Website |
RRID:Addgene_19705 | pgLAP4 | Chloramphenicol and Ampicillin | Backbone Marker:Invitrogen; Backbone Size:7638; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:35:16 | 0 | ||||
|
pWS-TK2 Resource Report Resource Website |
RRID:Addgene_20348 | pWS-TK2 | cloning vector | Chloramphenicol and Ampicillin | PMID:18546598 | The deposited sequence file of pWS-TK2 is from compilation of previous plasmids, and only part of it has been re-sequenced. There is a gap between author's sequence and Addgene sequence that will NOT affect the use of this plasmid. Please also note that Addgene's quality control sequencing indicates that the PacI and SgfI sites present in the depositor's map are not present in the plasmid's actual sequence. pWS-TK2 is designed to have two variants of thymidine kinase gene from herpes virus. | Backbone Size:0; Vector Backbone:N/A; Vector Types:Mouse Targeting; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:37:00 | 0 | |
|
pBPGw Resource Report Resource Website 1+ mentions |
RRID:Addgene_17574 | GAL4 | Saccharomyces cerevisiae | Chloramphenicol and Ampicillin | PMID:18621688 | pBPGw is a modular Gateway compatible promoter-less GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest. | Backbone Size:8902; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:29:45 | 7 | |
|
pBPGUw Resource Report Resource Website 10+ mentions |
RRID:Addgene_17575 | GAL4 | Saccharomyces cerevisiae | Chloramphenicol and Ampicillin | PMID:18621688 | pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest. | Backbone Size:9052; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:29:45 | 41 | |
|
pRedCm Resource Report Resource Website |
RRID:Addgene_176225 | Lambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage | Chloramphenicol and Ampicillin | PMID:35920321 | Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:29:54 | 0 | |||
|
pRedCmOcr Resource Report Resource Website |
RRID:Addgene_176226 | Lambda Red-T7ocr operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage | Chloramphenicol and Ampicillin | PMID:35920321 | Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:29:54 | 0 | |||
|
BL21 Rosetta2 ΔrecB GamS Resource Report Resource Website |
RRID:Addgene_176585 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | recB genomic deletion | 2026-09-01 09:30:00 | 0 | |
|
PB-TET Resource Report Resource Website 1+ mentions |
RRID:Addgene_20909 | Gateway Destination Vector | Chloramphenicol and Ampicillin | PMID:19252478 | Backbone Size:9370; Vector Backbone:pBluescript KS; Vector Types:Mammalian Expression, piggyBac; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:38:35 | 2 | |||
|
pKOR1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_133446 | Chloramphenicol and Ampicillin | PMID:16051359 | Vector Backbone:unknown; Vector Types:E.coli/S.aureus shuttle vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:18:22 | 1 | ||||
|
pMW#3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_13350 | LacZ reporter | Chloramphenicol and Ampicillin | PMID:16777607 | Please note mutation R15H in ccdB was found during Addgene's quality control process. The plasmid should function as reported in the associated publication. Please note that the ccdB cassette in the author's map (click on 'View map') is shown in the reverse orientation. Y1H Destination vector that can be used in conventional Gateway LR cloning reactions. This vector contains a Gateway cassette with AttR4 and AttL1 recombination sites and a LacZ reporter gene. For more information and protocols, see Deplancke et al. 2004 Genome Res 14(10B):2093 and Deplancke et al. 2006 CSH Protocols. | Backbone Marker:Clontech; Backbone Size:9700; Vector Backbone:pLacZi; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:18:23 | 4 | ||
|
pAWH Resource Report Resource Website |
RRID:Addgene_133894 | Chloramphenicol and Ampicillin | PMID:30217970 | Backbone Size:9866; Vector Backbone:pAWH; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:18:29 | 0 | ||||
|
pPB-tetpA-iRPT Resource Report Resource Website |
RRID:Addgene_140763 | iRFP713 | Rhodopseudomonas palustris | Chloramphenicol and Ampicillin | PMID:31586586 | Vector Backbone:pPB-MCSfw-pA; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:20:14 | 0 | ||
|
pT7gRNA-ccdb Resource Report Resource Website |
RRID:Addgene_140864 | ccdb/CAM | Synthetic | Chloramphenicol and Ampicillin | PMID:32709891 | Vector Backbone:pT7gRNA-ccdb; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:20:15 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
