Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: (Gly)5Ala::GFP-F64LS65T::tbb-2 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21637852
Proper citation: RRID:Addgene_21510 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::citrine (w introns)::(Gly)5Ala
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2643; Vector Backbone:pDONRP4P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21637852
Proper citation: RRID:Addgene_21508 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::GFP-F64LS65T::(Gly)5Ala
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2643; Vector Backbone:pDONRP4P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21637852
Proper citation: RRID:Addgene_21507 Copy
Species: Caenorhabditis elegans
Genetic Insert: pmex-5::GFP (w introns)::(Gly)5Ala
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2643; Vector Backbone:pDONRP4P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21637852
Proper citation: RRID:Addgene_21506 Copy
Species: Caenorhabditis elegans
Genetic Insert: pie-1>mCherry::PH domain (PLC-delta)
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:5712; Vector Backbone:pBS Sk-; Vector Types:bacterial propagation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19098902
Proper citation: RRID:Addgene_21743 Copy
Species: Caenorhabditis elegans
Genetic Insert: abu-1 promoter
Vector Backbone Description: Backbone Marker:Available at Addgene (#1494); Backbone Size:4487; Vector Backbone:pPD95_75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12186849
Comments: Addgene sequencing results show several mismatches with author's sequence.
abu-1::gfp C. elegans reporter gene. A 1.3-kb fragment of C. elegans genomic DNA immediately 5' of the predicted initiation ATG codon of abu-1 (AC3.3) was amplified by PCR using the oligonucleotides AC3.1S (5'-GGCATTGTGGCACGCATTGAACTG-3') and AC3Bam.2AS (5'-GATAGGATCCATTGTTAATATGCTTGAAGAGCTGC-3') and ligated in frame with the GFP coding region in the plasmid of pPD95.75.
Proper citation: RRID:Addgene_21824 Copy
Species: Caenorhabditis elegans
Genetic Insert: abu-1 promoter and coding region
Vector Backbone Description: Backbone Marker:Available at Addgene (#1494); Backbone Size:4487; Vector Backbone:pPD95_75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12186849
Comments: Addgene sequencing results show there is a S408P substitution in amino acid sequence in the coding region.
abu-1::abu-1::gfp C. elegans reporter gene. The promoter and coding region of abu-1 was ligated in frame with GFP to produce abu1::abu-1::gfp
Proper citation: RRID:Addgene_21825 Copy
Species: Caenorhabditis elegans
Genetic Insert: Myo 9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4673; Vector Backbone:pFast Bac 1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20538589
Comments: Sequencing of the C. elegans Myo9 cDNA that was obtained by reverse transcription-PCR revealed that it differed from the HUM-7 amino acid sequence at two positions. Residues 608–615 (VSPISPFW) were missing, and residues 731KKSAG735 were replaced by 731KSESAG736. Our deduced Myo9 amino acid sequence changes matched perfectly with the predicted Myo9 sequences for Caenorhabditis briggsae and Caenorhabditis remanei.
Proper citation: RRID:Addgene_134969 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pacr-2
Vector Backbone Description: Backbone Marker:Invitrogen Gateway; Backbone Size:4500; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20027209
Proper citation: RRID:Addgene_135092 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for cxTi10082 (actgttggatgcctgtgtag)
Vector Backbone Description: Backbone Marker:Goldstein Lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31378567
Proper citation: RRID:Addgene_135094 Copy
Species: Caenorhabditis elegans
Genetic Insert: [flp-6p::cmk-1::GFP]
Vector Backbone Description: Vector Backbone:pDEST R4R3; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29875264
Proper citation: RRID:Addgene_124613 Copy
Species: Caenorhabditis elegans
Genetic Insert: MBP-RGG-GFP-RGG (using LAF-1 RGG domain)
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061688
Proper citation: RRID:Addgene_124949 Copy
Species: Caenorhabditis elegans
Genetic Insert: MBP-RGG-RGG (using LAF-1 RGG domain)
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061688
Proper citation: RRID:Addgene_124946 Copy
Species: Caenorhabditis elegans
Genetic Insert: SYNZIP1-RGG-RGG (using LAF-1 RGG domain)
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061688
Proper citation: RRID:Addgene_124942 Copy
Species: Caenorhabditis elegans
Genetic Insert: RGG-RGG-RGG (using LAF-1 RGG domain)
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061688
Proper citation: RRID:Addgene_124938 Copy
Species: Caenorhabditis elegans
Genetic Insert: SYNZIP1-RGG-GFP-RGG (using LAF-1 RGG domain)
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30061688
Proper citation: RRID:Addgene_124932 Copy
Species: Caenorhabditis elegans
Genetic Insert: LAF-1 RGG domain
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061688
Proper citation: RRID:Addgene_124929 Copy
Species: Caenorhabditis elegans
Genetic Insert: pptr-2
Vector Backbone Description: Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535836
Proper citation: RRID:Addgene_131375 Copy
Species: Caenorhabditis elegans
Genetic Insert: paa-1
Vector Backbone Description: Backbone Marker:Jason Pellettieri ; Backbone Size:8356; Vector Backbone:pMAL-c2X (MBP fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535836
Proper citation: RRID:Addgene_131373 Copy
Species: Caenorhabditis elegans
Genetic Insert: meg-3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX6p1 (GST-fusion); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535836
Proper citation: RRID:Addgene_131369 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
