Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: Gateway(R4-R3)
Defining Citation: PMID:18723890
Comments: Sequence mismatches between Addgene sequence and depositor sequence do not affect function.
Proper citation: RRID:Addgene_19676 Copy
Species: Caenorhabditis elegans
Genetic Insert: Gateway(R1-R2)
Defining Citation: PMID:18723890
Proper citation: RRID:Addgene_19675 Copy
Species: Caenorhabditis elegans
Genetic Insert: Gateway(R1-R2)-L4440
Vector Backbone Description: Backbone Size:0; Vector Backbone:L4440; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18723890
Proper citation: RRID:Addgene_19678 Copy
Species: Caenorhabditis elegans
Genetic Insert: Gateway(R4-R3)
Defining Citation: PMID:18723890
Proper citation: RRID:Addgene_19677 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7624; Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_19702 Copy
Genetic Insert: pgLAP3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8325; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_19704 Copy
Genetic Insert: pgLAP5
Vector Backbone Description: Backbone Size:8365; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_19706 Copy
Genetic Insert: pgLAP4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7638; Vector Backbone:pEF5/FRT-V5; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_19705 Copy
Species: cloning vector
Genetic Insert: pWS-TK2
Vector Backbone Description: Backbone Size:0; Vector Backbone:N/A; Vector Types:Mouse Targeting; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18546598
Comments: The deposited sequence file of pWS-TK2 is from compilation of previous plasmids, and only part of it has been re-sequenced. There is a gap between author's sequence and Addgene sequence that will NOT affect the use of this plasmid.
Please also note that Addgene's quality control sequencing indicates that the PacI and SgfI sites present in the depositor's map are not present in the plasmid's actual sequence.
pWS-TK2 is designed to have two variants of thymidine kinase gene from herpes virus.
Proper citation: RRID:Addgene_20348 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Size:8902; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18621688
Comments: pBPGw is a modular Gateway compatible promoter-less GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.
Proper citation: RRID:Addgene_17574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Size:9052; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18621688
Comments: pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.
Proper citation: RRID:Addgene_17575 Copy
Genetic Insert: Lambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
Vector Backbone Description: Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35920321
Proper citation: RRID:Addgene_176225 Copy
Genetic Insert: Lambda Red-T7ocr operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
Vector Backbone Description: Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35920321
Proper citation: RRID:Addgene_176226 Copy
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recB deletion verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
Proper citation: RRID:Addgene_176585 Copy
Genetic Insert: Gateway Destination Vector
Vector Backbone Description: Backbone Size:9370; Vector Backbone:pBluescript KS; Vector Types:Mammalian Expression, piggyBac; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19252478
Proper citation: RRID:Addgene_20909 Copy
Vector Backbone Description: Vector Backbone:unknown; Vector Types:E.coli/S.aureus shuttle vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16051359
Proper citation: RRID:Addgene_133446 Copy
Genetic Insert: LacZ reporter
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9700; Vector Backbone:pLacZi; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16777607
Comments: Please note mutation R15H in ccdB was found during Addgene's quality control process. The plasmid should function as reported in the associated publication.
Please note that the ccdB cassette in the author's map (click on 'View map') is shown in the reverse orientation.
Y1H Destination vector that can be used in conventional Gateway LR cloning reactions. This vector contains a Gateway cassette with AttR4 and AttL1 recombination sites and a LacZ reporter gene. For more information and protocols, see Deplancke et al. 2004 Genome Res 14(10B):2093 and Deplancke et al. 2006 CSH Protocols.
Proper citation: RRID:Addgene_13350 Copy
Vector Backbone Description: Backbone Size:9866; Vector Backbone:pAWH; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30217970
Proper citation: RRID:Addgene_133894 Copy
Species: Rhodopseudomonas palustris
Genetic Insert: iRFP713
Vector Backbone Description: Vector Backbone:pPB-MCSfw-pA; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31586586
Proper citation: RRID:Addgene_140763 Copy
Species: Synthetic
Genetic Insert: ccdb/CAM
Vector Backbone Description: Vector Backbone:pT7gRNA-ccdb; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32709891
Proper citation: RRID:Addgene_140864 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
