Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21418658
Comments: The full plasmid sequence was assembled and may contain minor discrepancies, which should not affect the function of the plasmid.
Proper citation: RRID:Addgene_32684 Copy
Vector Backbone Description: Backbone Size:8453; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21418658
Proper citation: RRID:Addgene_32682 Copy
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21418658
Comments: The full plasmid sequence was digitally assembled and may contain minor discrepancies, which should not effect the function of the plasmid.
Proper citation: RRID:Addgene_32685 Copy
Vector Backbone Description: Backbone Size:4427; Vector Backbone:pACAGW-ChR2-Venus-AAV; Vector Types:AAV, aav; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21772812
Proper citation: RRID:Addgene_32671 Copy
Genetic Insert: pie-1promoter-GFP- gateway destination cassette B -pie-1 3’
Vector Backbone Description: Backbone Size:12296; Vector Backbone:pie-1; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18692039
Comments: For expressing GFP-ORF fusions in the germline. This vector does not contain unc-119 sequences and therefore must be co-injected with a marker (typically we use pRF4 in complex array injections - Kelly et al., 1997)
Proper citation: RRID:Addgene_26952 Copy
Vector Backbone Description: Backbone Size:0; Vector Backbone:N/A; Vector Types:E.coli bacterial strain; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19633652
Comments: MG1655, bla, bio-, lambda-Red1, mutS–, cmR
From the paper: mutS in EcNR1 was replaced with the chloramphenicol resistance gene (cmR cassette).
Proper citation: RRID:Addgene_26931 Copy
Genetic Insert: pUC/ori, bla
Vector Backbone Description: Backbone Marker:Gateway(R) (Invitrogen); Backbone Size:3012; Vector Backbone:pDONRP2R-P3; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21203517
Proper citation: RRID:Addgene_27367 Copy
Genetic Insert: Hygromycin resistance
Vector Backbone Description: Backbone Size:7654; Vector Backbone:pCFJ201; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31378567
Proper citation: RRID:Addgene_135096 Copy
Species: Synthetic
Genetic Insert: Lvl0 3'UTR Dest
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30327560
Proper citation: RRID:Addgene_115952 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC).
Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.
Proper citation: RRID:Addgene_11663 Copy
Species: Other
Genetic Insert: D. pseudoobscura peak #102 enhancer and D. pseudoobscura CG13116 CP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2962; Vector Backbone:Unknown; Vector Types:Insect Expression, Gateway fly expression vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928
Proper citation: RRID:Addgene_125153 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: 4 x upstream activating sequence (UAS)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928
Proper citation: RRID:Addgene_125150 Copy
Species: Other
Genetic Insert: D. pseudoobscura peak #47 enhancer
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3078; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928
Proper citation: RRID:Addgene_125151 Copy
Vector Backbone Description: Backbone Marker:we built; Backbone Size:10101; Vector Backbone:custom made; Vector Types:Mammalian Expression, Yeast Expression, in vitro expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31467278
Comments: Addgene NGS results identified an IS4-like element located between the Chloramphenicol resistance and ccdB genes. This element will not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/530790v1.full for bioRxiv preprint.
Proper citation: RRID:Addgene_125549 Copy
Vector Backbone Description: Backbone Marker:Vidali Lab; Backbone Size:11239; Vector Backbone:pGAPi; Vector Types:RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32764132
Proper citation: RRID:Addgene_127547 Copy
Vector Backbone Description: Backbone Size:11000; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_128322 Copy
Species: Aequorea victoria
Genetic Insert: Venus
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:7470; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27455993
Comments: 5' cloning site: AgeI (unknown if destroyed), 3' cloning site: MluI (unknown if destroyed)
Proper citation: RRID:Addgene_128567 Copy
Species: Aequorea victoria
Genetic Insert: Venus
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:7470; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27455993
Comments: 5' cloning site: AgeI (unknown if destroyed), 3' cloning site: MluI (unknown if destroyed)
Proper citation: RRID:Addgene_128566 Copy
Genetic Insert: cat, sacB
Vector Backbone Description: Backbone Size:0; Vector Backbone:pTP809; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:10767554
Comments: pKM154 is a derivative of pBR322 that had sequence between the EcoR1 site and NdeI site removed, with a NotI site inserted (pTP809).
Proper citation: RRID:Addgene_13036 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:5778; Vector Backbone:na; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17948311
Proper citation: RRID:Addgene_13071 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
