Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 56 showing 1101 ~ 1120 out of 4,489 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_44525

http://www.addgene.org/44525

Species: Saccharomyces cerevisiae
Genetic Insert: P(GAL10)-HHT2 P(GAL1)-HHF2
Vector Backbone Description: Vector Backbone:pUK420; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519

Proper citation: RRID:Addgene_44525 Copy   


  • RRID:Addgene_44528

http://www.addgene.org/44528

Species: Saccharomyces cerevisiae
Genetic Insert: HHF2-HHT2
Vector Backbone Description: Vector Backbone:pRS314-B; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519

Proper citation: RRID:Addgene_44528 Copy   


  • RRID:Addgene_44527

http://www.addgene.org/44527

Species: Saccharomyces cerevisiae
Genetic Insert: HHT2
Vector Backbone Description: Vector Backbone:pLJ999T; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519

Proper citation: RRID:Addgene_44527 Copy   


  • RRID:Addgene_44529

http://www.addgene.org/44529

Species: Saccharomyces cerevisiae
Genetic Insert: HHF2-HHT2
Vector Backbone Description: Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519

Proper citation: RRID:Addgene_44529 Copy   


  • RRID:Addgene_44521

http://www.addgene.org/44521

Species: Saccharomyces cerevisiae
Genetic Insert: Histone 3 N-terminus
Vector Backbone Description: Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7867066
Comments: Addgene QC found a point mutation in H3--this does not affect plasmid function.

Proper citation: RRID:Addgene_44521 Copy   


http://www.addgene.org/44753

Species: Saccharomyces cerevisiae
Genetic Insert: MAG1-sctetR
Vector Backbone Description: Backbone Size:4800; Vector Backbone:PRS303; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23470991
Comments: Please note that Addgene's sequencing results identified a few nucleotide differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing lab, these differences are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_44753 Copy   


  • RRID:Addgene_44860

http://www.addgene.org/44860

Species: Saccharomyces cerevisiae
Genetic Insert: ADH4-PURA3-URA3-G8-yEGFP1-CLN2PD-NLSSV40-TURA3-TG
Vector Backbone Description: Vector Backbone:pTK021; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23124068

Proper citation: RRID:Addgene_44860 Copy   


  • RRID:Addgene_44962

http://www.addgene.org/44962

Species: Saccharomyces cerevisiae
Genetic Insert: LEU2
Vector Backbone Description: Vector Backbone:pMSl91; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1505519

Proper citation: RRID:Addgene_44962 Copy   


http://www.addgene.org/45925

Species: Saccharomyces cerevisiae
Genetic Insert: yeast Vps23
Vector Backbone Description: Backbone Size:6103; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21505419

Proper citation: RRID:Addgene_45925 Copy   


  • RRID:Addgene_46137

    This resource has 1+ mentions.

http://www.addgene.org/46137

Species: Saccharomyces cerevisiae
Genetic Insert: GAL80
Vector Backbone Description: Backbone Size:8938; Vector Backbone:pQUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_46137 Copy   


  • RRID:Addgene_46357

    This resource has 1+ mentions.

http://www.addgene.org/46357

Species: Saccharomyces cerevisiae
Genetic Insert: Lifeact
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127

Proper citation: RRID:Addgene_46357 Copy   


  • RRID:Addgene_46923

http://www.addgene.org/46923

Species: Saccharomyces cerevisiae
Genetic Insert: sgRNA targeting endogenous TRE elements of pTET07 promoter
Vector Backbone Description: Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence TATCAGTGATAGAGAAAAGT

Proper citation: RRID:Addgene_46923 Copy   


  • RRID:Addgene_47049

    This resource has 1+ mentions.

http://www.addgene.org/47049

Species: Saccharomyces cerevisiae
Genetic Insert: Codon-optimized sequences for MEV pathway expression in E. coli to produce limonene
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pBbA5a; Vector Types:Bacterial Expression, Synthetic Biology, BglBrick; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727191
Comments: The R364S mutation in the MK is not known to alter the function. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_47049 Copy   


  • RRID:Addgene_47764

http://www.addgene.org/47764

Species: Saccharomyces cerevisiae
Genetic Insert: MepTrac-H194E
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931

Proper citation: RRID:Addgene_47764 Copy   


  • RRID:Addgene_47768

http://www.addgene.org/47768

Species: Saccharomyces cerevisiae
Genetic Insert: meptrac
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pDR GW; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931

Proper citation: RRID:Addgene_47768 Copy   


  • RRID:Addgene_48233

    This resource has 1+ mentions.

http://www.addgene.org/48233

Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451

Proper citation: RRID:Addgene_48233 Copy   


  • RRID:Addgene_52533

http://www.addgene.org/52533

Species: Saccharomyces cerevisiae
Genetic Insert: I-SceI
Vector Backbone Description: Backbone Size:10877; Vector Backbone:pCASPER5; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24748663

Proper citation: RRID:Addgene_52533 Copy   


http://www.addgene.org/52889

Species: Saccharomyces cerevisiae
Genetic Insert: Gal4
Vector Backbone Description: Backbone Marker:David Strutt (Brittle et al., 2010); Vector Backbone:pAct5-FRT-stop-FRT-SV40polyA attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25605786

Proper citation: RRID:Addgene_52889 Copy   


http://www.addgene.org/53205

Species: Saccharomyces cerevisiae
Genetic Insert: GAL1 promoter
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Comments: GFP in Addgene plasmid #41614 was replaced with stable GFP variant (F64L, S65T, V163A).

Proper citation: RRID:Addgene_53205 Copy   


http://www.addgene.org/53184

Species: Saccharomyces cerevisiae
Genetic Insert: TRP1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast genomic targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17942599
Comments: This plasmid is similar to Addgene plasmid #41597, except the GFP has been switched to a more stable variant.

Proper citation: RRID:Addgene_53184 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X