Plasmids   Select Another Resource Report Type

http://www.addgene.org/118629

Genetic Insert: ccdb
Vector Backbone Description: Vector Backbone:I-SceI; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32709891

Proper citation: RRID:Addgene_118629 Copy   

•   Source: Addgene

http://www.addgene.org/118628

Genetic Insert: ccdb
Vector Backbone Description: Vector Backbone:I-SceI; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32709891

Proper citation: RRID:Addgene_118628 Copy   

•   Source: Addgene

http://www.addgene.org/118752

Genetic Insert: ccdb
Vector Backbone Description: Vector Backbone:I-SceI; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32709891

Proper citation: RRID:Addgene_118752 Copy   

•   Source: Addgene

http://www.addgene.org/119752

Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX-6-P1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_119752 Copy   

•   Source: Addgene

http://www.addgene.org/119745

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:29959219

Proper citation: RRID:Addgene_119745 Copy   

•   Source: Addgene

http://www.addgene.org/127547

Vector Backbone Description: Backbone Marker:Vidali Lab; Backbone Size:11239; Vector Backbone:pGAPi; Vector Types:RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32764132

Proper citation: RRID:Addgene_127547 Copy   

•   Source: Addgene

http://www.addgene.org/128322

Vector Backbone Description: Backbone Size:11000; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_128322 Copy   

•   Source: Addgene

http://www.addgene.org/128567

Species: Aequorea victoria
Genetic Insert: Venus
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:7470; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27455993
Comments: 5' cloning site: AgeI (unknown if destroyed), 3' cloning site: MluI (unknown if destroyed)

Proper citation: RRID:Addgene_128567 Copy   

•   Source: Addgene

http://www.addgene.org/128566

Species: Aequorea victoria
Genetic Insert: Venus
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:7470; Vector Backbone:pDEST15; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:27455993
Comments: 5' cloning site: AgeI (unknown if destroyed), 3' cloning site: MluI (unknown if destroyed)

Proper citation: RRID:Addgene_128566 Copy   

•   Source: Addgene

http://www.addgene.org/11663

Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.

Proper citation: RRID:Addgene_11663 Copy   

•   Source: Addgene

http://www.addgene.org/117379

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6332; Vector Backbone:T-Vector pMD19 (Simple); Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31740773
Comments: This plasmid is designed for transient transfection of protoplasts. It has only been validated in Zea mays mesophyll protoplasts. The region containing the ccdB suicide gene is dropped out by a double-digest with SacI and KpnI and the large fragment is recombined with the DNA insert library.

Proper citation: RRID:Addgene_117379 Copy   

•   Source: Addgene

http://www.addgene.org/125153

Species: Other
Genetic Insert: D. pseudoobscura peak #102 enhancer and D. pseudoobscura CG13116 CP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2962; Vector Backbone:Unknown; Vector Types:Insect Expression, Gateway fly expression vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928

Proper citation: RRID:Addgene_125153 Copy   

•   Source: Addgene

http://www.addgene.org/125150

Species: Saccharomyces cerevisiae
Genetic Insert: 4 x upstream activating sequence (UAS)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928

Proper citation: RRID:Addgene_125150 Copy   

•   Source: Addgene

http://www.addgene.org/125151

Species: Other
Genetic Insert: D. pseudoobscura peak #47 enhancer
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3078; Vector Backbone:Unknown; Vector Types:STAP-seq screening vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31092928

Proper citation: RRID:Addgene_125151 Copy   

•   Source: Addgene

http://www.addgene.org/125549

Vector Backbone Description: Backbone Marker:we built; Backbone Size:10101; Vector Backbone:custom made; Vector Types:Mammalian Expression, Yeast Expression, in vitro expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:31467278
Comments: Addgene NGS results identified an IS4-like element located between the Chloramphenicol resistance and ccdB genes. This element will not affect plasmid function. Please visit https://www.biorxiv.org/content/10.1101/530790v1.full for bioRxiv preprint.

Proper citation: RRID:Addgene_125549 Copy   

•   Source: Addgene

http://www.addgene.org/13668

Genetic Insert: Gateway cassette
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4720; Vector Backbone:pQE-2; Vector Types:Bacterial Expression, Co-Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17311810
Comments: Please note that the chloramphenicol resistance gene outside of the attB sites in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.

Proper citation: RRID:Addgene_13668 Copy   

•   Source: Addgene

http://www.addgene.org/13673

Genetic Insert: Gateway cassette
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:5356; Vector Backbone:pQE-2; Vector Types:Bacterial Expression, Co-Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17311810
Comments: Please note that the chloramphenicol resistance gene outside the attB sites in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.

Proper citation: RRID:Addgene_13673 Copy   

•   Source: Addgene

http://www.addgene.org/15300

Vector Backbone Description: Backbone Size:0; Vector Backbone:pWZL-Neo-Myr-Flag-DEST; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17574021
Comments: pWZL-Neo-Myr-Flag-DEST (pWN-MF-DEST) is a Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORF. Created by inserting an N-terminal myr-FLAG tag and the Gateway-selectable cassette into the pWzl-Neo retroviral vector. To create specific pWN-MF-ORF vectors, perform site-specific LR recombination reactions. LR reaction: 150ng DEST vector + 50ng ENTRY vector + 10xLR Buffer + LR enzyme + dH20. Incubate at 25oC for 1 hour. Add 1uL Proteinase K (20mg/ml), and incubate at 37oC for 10min. Transform into DH5alpha cells. See Invitrogen's website for detailed protocols and for LR enzyme.

Proper citation: RRID:Addgene_15300 Copy   

•   Source: Addgene

http://www.addgene.org/153241

Vector Backbone Description: Backbone Size:2700; Vector Backbone:pUC57-BsaI; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33577114
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.03.31.018671v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_153241 Copy   

•   Source: Addgene

http://www.addgene.org/153243

Vector Backbone Description: Backbone Size:2700; Vector Backbone:pUC57-BsaI; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33577114
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.03.31.018671v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_153243 Copy   

•   Source: Addgene