Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: mTFP1::[(G4S)3]::C-TAP Tag
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42166 Copy
Species: Caenorhabditis elegans
Genetic Insert: N-TAP Tag-RT-::mTFP1
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42162 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTFP1::linker::2xNLS
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42149 Copy
Species: Caenorhabditis elegans
Genetic Insert: TAP-tag
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2131; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Proper citation: RRID:Addgene_42144 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTFP1::linker::TAP TAG
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42148 Copy
Species: Caenorhabditis elegans
Genetic Insert: let-363 cDNA
Vector Backbone Description: Backbone Size:2790; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin and Tetracycline
Defining Citation: PMID:22278922
Comments: This plasmid can be kept in DH5alpha cells but does not work for RNAi in that strain. For RNAi, please transform DNA into the HT115 strain.
Proper citation: RRID:Addgene_42600 Copy
Species: Caenorhabditis elegans
Genetic Insert: daf-15
Vector Backbone Description: Backbone Size:2790; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin and Tetracycline
Defining Citation: PMID:22278922
Comments: This plasmid can be kept in DH5alpha cells but does not work for RNAi in that strain. For RNAi, please transform DNA into the HT115 strain.
Note: Addgene's quality control sequencing has found that the deposited clone contains a T to C mismatch with respect to the C. elegans N2 reference daf-15 sequence, which would cause a V797A change in the coded protein. According to the depositing lab, this point mutation does not affect RNAi feeding; however, its possible effects in other contexts are not known.
Proper citation: RRID:Addgene_42601 Copy
Species: Caenorhabditis elegans
Genetic Insert: Ce-age-1 promoter (873 bp)::Ce-age-1 cDNA (3549 bp)::Ce-unc-54 terminator (765 bp)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22701676
Comments: The construct Ce-age-1p::Ce-age-1(3,549bp)::Ce-unc-54t, contained in plasmid pPV454, was assembled by overlap extension PCR. An 873 bp segment of Ce-age-1 5′ region was amplified from genomic DNA and fused to 2,376 bp of the 5′ region of Ce-age-1, amplified from cDNA, using the overlapping primers Ceage1p-cDNA-F and -R (below). This was subsequently fused to the remainder of the Ce-age-1 cDNA with the plasmid Pdpy-30-age-1, a gift from Yuichi Iino (University of Tokyo, Tokyo, Japan), as template and using the overlapping primers Ceage1-Cat-F and -R (below). Finally, the promoter and full-length 3,549 bp Ce-age-1 cDNA were fused to 765 bp of the Ce-unc-54 3′ region (terminator), amplified from Pdpy-30-age-1 template, using the overlapping primers Ceage1-unc54-F and -R (below). The PCR product was T/A cloned into the pCR4-TOPO vector (Life Technologies) and the insert fully sequenced.
Ceage1p-cDNA-F caagctttcattttaagattttaagATGTCTATGGGACGAAGCCCCTC
Ceage1p-cDNA-R GAGGGGCTTCGTCCCATAGACATcttaaaatcttaaaatgaaagcttg
Ceage1-Cat-F CCTCCGTGGAAATGAAGAGCACatcaagatcatcacccgacaag
Ceage1-Cat-R cttgtcgggtgatgatcttgatGTGCTCTTCATTTCCACGGAGG
Ceage1-unc54-F CCACGCAGTCAAACACTACTGAgataagagctccgcatcggccg
Ceage1-unc54-R cggccgatgcggagctcttatcTCAGTAGTGTTTGACTGCGTGG
Proper citation: RRID:Addgene_42922 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-22 sgRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24879462
Comments: gRNA target sequence GAACCCGTTGCCGAATACAC
Proper citation: RRID:Addgene_58202 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-207
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59554 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59551 Copy
Species: Caenorhabditis elegans
Genetic Insert: 1-208
Vector Backbone Description: Vector Backbone:pET28; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20462958
Proper citation: RRID:Addgene_59552 Copy
Species: Caenorhabditis elegans
Genetic Insert: cdc-42 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555
Proper citation: RRID:Addgene_59785 Copy
Species: Caenorhabditis elegans
Genetic Insert: hsp-16.41 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555
Proper citation: RRID:Addgene_59789 Copy
Species: Caenorhabditis elegans
Genetic Insert: elt-2 promoter
Vector Backbone Description: Vector Backbone:pCFJ150; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25377555
Proper citation: RRID:Addgene_59783 Copy
Species: Caenorhabditis elegans
Genetic Insert: unc-58(e665) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212
Proper citation: RRID:Addgene_59931 Copy
Species: Caenorhabditis elegans
Genetic Insert: rol-6(su1006) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212
Proper citation: RRID:Addgene_59930 Copy
Species: Caenorhabditis elegans
Genetic Insert: dpy-10(cn64) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212
Proper citation: RRID:Addgene_59933 Copy
Species: Caenorhabditis elegans
Genetic Insert: klp-16
Vector Backbone Description: Backbone Marker:Andrew Fire; Backbone Size:2790; Vector Backbone:L4440; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25066299
Comments: Source BioScience LifeSciences C. elegans RNAi library clones utilized in plasmid construction (Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000) Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408, 325–330.)
Proper citation: RRID:Addgene_59998 Copy
Species: Caenorhabditis elegans
Genetic Insert: rde-1(D801) gRNA
Vector Backbone Description: Vector Backbone:pRB1017; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25161212
Proper citation: RRID:Addgene_59928 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
