Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: hSyn Galpha-i3 ONE-GO
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38412860
Proper citation: RRID:Addgene_204334 Copy
Species: Rattus norvegicus
Genetic Insert: hSyn Galpha-oA ONE-GO
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38412860
Proper citation: RRID:Addgene_204335 Copy
Species: Rattus norvegicus
Genetic Insert: hSyn Galpha-i1 ONE-GO
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38412860
Proper citation: RRID:Addgene_204333 Copy
Species: Rattus norvegicus
Genetic Insert: Galpha-oA ONE-GO
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38412860
Proper citation: RRID:Addgene_189732 Copy
Species: Rattus norvegicus
Genetic Insert: Galpha-oB ONE-GO
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38412860
Proper citation: RRID:Addgene_189733 Copy
Species: Rattus norvegicus
Genetic Insert: Galpha-i3 ONE-GO
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38412860
Proper citation: RRID:Addgene_189737 Copy
Species: Rattus norvegicus
Genetic Insert: SV40 Galpha-i3 ONE-GO
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hygro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38412860
Proper citation: RRID:Addgene_204329 Copy
Species: Rattus norvegicus
Genetic Insert: His-DIO GCaMP8f
Vector Backbone Description: Backbone Size:4699; Vector Backbone:pX552; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38871457
Comments: pX552 was a gift from Feng Zhang (Addgene plasmid # 60958 ; http://n2t.net/addgene:60958 ; RRID:Addgene_60958)
Proper citation: RRID:Addgene_199580 Copy
Species: Rattus norvegicus
Genetic Insert: Omp25
Vector Backbone Description: Backbone Size:6101; Vector Backbone:pMRX-IPU; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39288101
Proper citation: RRID:Addgene_228137 Copy
Species: Rattus norvegicus
Genetic Insert: LAP2b
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37098350
Proper citation: RRID:Addgene_228029 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:10726; Vector Backbone:FUWG-RUSH-Strep-KDEL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40016183
Comments: Please visit https://doi.org/10.1101/2024.05.16.594502 for bioRxiv preprint.
Proper citation: RRID:Addgene_228526 Copy
Species: Rattus norvegicus
Genetic Insert: macroH2A1.2-GFP
Vector Backbone Description: Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39189450
Proper citation: RRID:Addgene_223708 Copy
Species: Rattus norvegicus
Genetic Insert: Neurofilament-Medium tail domain, charge shuffle 1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39602260
Proper citation: RRID:Addgene_232058 Copy
Species: Rattus norvegicus
Genetic Insert: Neurofilament-Heavy tail domain
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39602260
Proper citation: RRID:Addgene_232057 Copy
Species: Rattus norvegicus
Genetic Insert: Neurofilament-Medium tail domain
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39602260
Proper citation: RRID:Addgene_232056 Copy
Species: Rattus norvegicus
Genetic Insert: Rat Arc
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_233053 Copy
Species: Rattus norvegicus
Genetic Insert: 1EYH
Vector Backbone Description: Backbone Size:5679; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:42555168
Comments: 5' cloning site: BsaI (destroyed), 3' cloning site: BsaI (destroyed)
Proper citation: RRID:Addgene_234159 Copy
Species: Rattus norvegicus
Genetic Insert: CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG)
Vector Backbone Description: Backbone Marker:Dr Konstantin Kogan; Backbone Size:14900; Vector Backbone:pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37226896
Proper citation: RRID:Addgene_202556 Copy
Species: Rattus norvegicus
Genetic Insert: G-PTEN sensor, mEGFP-PTEN-sREACh
Vector Backbone Description: Vector Backbone:CAG CyRFP1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39979596
Comments: Please visit https://doi.org/10.1101/2024.10.04.616644 for bioRxiv preprint.
Proper citation: RRID:Addgene_227436 Copy
Species: Rattus norvegicus
Genetic Insert: G-PTEN sensor
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pAAV FLEX CAG; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39979596
Comments: Expression is Cre dependent.
Please visit https://doi.org/10.1101/2024.10.04.616644 for bioRxiv preprint.
Proper citation: RRID:Addgene_227438 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
