Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: SUMO
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pBACgus_SUMOstar; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_40388 Copy
Species: Synthetic
Genetic Insert: Aurora B FRET-sensor
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5125; Vector Backbone:pIRES-puro2b; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22801782
Proper citation: RRID:Addgene_40731 Copy
Species: Synthetic
Genetic Insert: Leucine Zipper prime - C super positive Green Fluorescent Protein
Vector Backbone Description: Backbone Size:4496; Vector Backbone:pMRBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22692102
Proper citation: RRID:Addgene_40730 Copy
Species: Synthetic
Genetic Insert: CFP-24xPP7
Vector Backbone Description: Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: Please note that the final PP7 stem loop ends with CCAGCAGAGCATATGGGCTCG The depositing laboratory confirmed that the plasmid functions as described in the associated publication.
The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:
taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt
Proper citation: RRID:Addgene_40652 Copy
Species: Synthetic
Genetic Insert: CFP-24xMBS
Vector Backbone Description: Vector Backbone:pHAGE-CMV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The Singer Lab no longer recommends this plasmid, as it has a higher rate of bacterial recombination.
For mammalian cells they recommend the following plasmids:
pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Plasmid #84561)
HaloTag-bActinCDS-bActinUTR-MS2V5 (Plasmid #102718)
For yeast cells they recommend the following plasmids:
pET246-pUC57 12xMS2V6 (Plasmid #104390)
pET259-pUC57 24xMS2V6 (Plasmid #104391)
pET251-pUC 12xMS2V6 Loxp KANr Loxp (Plasmid #104392)
pET264-pUC 24xMS2V6 Loxp KANr Loxp (Plasmid #104393)
Due to the propensity of the plasmid to recombine, Addgene recommends screening multiple colonies by restriction analysis to ensure that the isolated clones contain a full set of 24 MS2 repeats
Proper citation: RRID:Addgene_40651 Copy
Species: Synthetic
Genetic Insert: tdPCP-gfp
Vector Backbone Description: Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC
Proper citation: RRID:Addgene_40650 Copy
Species: Synthetic
Genetic Insert: tdMCP-gfp
Vector Backbone Description: Vector Backbone:pHAGE-UBC-RIG (modified); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22735544
Comments: The linker region between the two MCPs is ATCTACGCCATGGCTTCT
Proper citation: RRID:Addgene_40649 Copy
Species: Synthetic
Genetic Insert: Cerulean
Vector Backbone Description: Backbone Size:6336; Vector Backbone:PBCAG-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22521325
Proper citation: RRID:Addgene_40997 Copy
Species: Synthetic
Genetic Insert: mRFP
Vector Backbone Description: Backbone Size:6336; Vector Backbone:PBCAG-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22521325
Proper citation: RRID:Addgene_40996 Copy
Species: Synthetic
Genetic Insert: PiggyBac transposon 3' terminal repeats
Vector Backbone Description: Backbone Size:5551; Vector Backbone:pCAGGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22521325
Proper citation: RRID:Addgene_40973 Copy
Species: Synthetic
Genetic Insert: 6xmiR307_21nt-nearperfect
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41098 Copy
Species: Synthetic
Genetic Insert: taranismutant3'UTR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41107 Copy
Species: Synthetic
Genetic Insert: taranis3'UTR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41106 Copy
Species: Synthetic
Genetic Insert: Gk3'UTR
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41104 Copy
Species: Synthetic
Genetic Insert: 8xmiR307_21nt-seedonly
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41103 Copy
Species: Synthetic
Genetic Insert: 4xmiR307_23nt-seedonly
Vector Backbone Description: Backbone Size:6000; Vector Backbone:siCheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653
Proper citation: RRID:Addgene_41100 Copy
Species: synthetic
Genetic Insert: lox-EM7p-Zeo-lox cassette flanked by Tn5 outer element
Vector Backbone Description: Backbone Marker:Epicentre; Backbone Size:2000; Vector Backbone:pMOD
Defining Citation: PMID:15784610
Comments: Note that Bleomycin and Zeocin are the same antibiotic.
Proper citation: RRID:Addgene_27182 Copy
Species: synthetic
Genetic Insert: MC1 promoter diphtheria toxin-A fragment
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2800; Vector Backbone:pBluescript II; Vector Types:Mammalian Expression, Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15784610
Comments: The MCS in the pBSDT-AII is extensibly modified by synthetic oligos to create multiple rare restriction sites
Proper citation: RRID:Addgene_27179 Copy
Species: Synthetic
Genetic Insert: NLS YFP
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Proper citation: RRID:Addgene_37341 Copy
Species: Synthetic
Genetic Insert: membrane Venus
Vector Backbone Description: Backbone Marker:clontech; Backbone Size:6000; Vector Backbone:pQC; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21397594
Proper citation: RRID:Addgene_37343 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.