Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: C-terminal domain (327-970) containing 5 impaired Edc3 binding sites (5 additional HLMs in C-terminal domain); N-terminal domain (1-299) including first HLM is removed.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163581 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163585 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding site (first HLM); impaired RNA cap recognition site (W50, D54).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163580 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163577 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: P-rhaP-BAD-malE-His tag-smt3-eGFP
Vector Backbone Description: Vector Backbone:pTST101 ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19127343
Proper citation: RRID:Addgene_135085 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CMVpr hph ADH1t
Vector Backbone Description: Backbone Size:4287; Vector Backbone:pRS406; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32392127
Proper citation: RRID:Addgene_135414 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SpunHsp70pr hph-GFP ADH1t
Vector Backbone Description: Backbone Size:9369; Vector Backbone:pGI3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32392127
Comments: The pGI3 vector was a gift from Giuseppe Ianiri
Proper citation: RRID:Addgene_135482 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SpunH2Bpr hph-GFP ADH1t
Vector Backbone Description: Backbone Size:9576; Vector Backbone:pGI3; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32392127
Comments: The pGI3 vector was a gift from Giuseppe Ianiri
Proper citation: RRID:Addgene_135483 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: hph SpunH2A/Bpr hph-mCitrine
Vector Backbone Description: Backbone Size:10906; Vector Backbone:pGI3EM18; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32392127
Comments: mCitrine was obtained by PCR of mCitrine-PCNA-19-SV40NLS-4 (Addgene plasmid # 56564), a plasmid created by the Davidson lab
The pGI3 vector was a gift from Giuseppe Ianiri
Proper citation: RRID:Addgene_135489 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: hph SpunH2A/Bpr hph-mClover3
Vector Backbone Description: Backbone Size:10906; Vector Backbone:pGI3EM18; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32392127
Comments: mClover3 was obtained by PCR of pKK-mClover3-TEV (Addgene plasmid \# 105778), a plasmid created by the Dziembowski lab
The pGI3 vector was a gift from Giuseppe Ianiri
Proper citation: RRID:Addgene_135490 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: KAP123
Vector Backbone Description: Backbone Size:7300; Vector Backbone:pPS934; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9238021
Comments: KAP123 replaces NUF2 of pPS934, CEN plasmid.
Proper citation: RRID:Addgene_1355 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: snR6
Vector Backbone Description: Vector Backbone:pSE358; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31558568
Proper citation: RRID:Addgene_135590 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: snR6
Vector Backbone Description: Vector Backbone:pSE358; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31558568
Proper citation: RRID:Addgene_135586 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: snR6
Vector Backbone Description: Vector Backbone:pSE358; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31558568
Proper citation: RRID:Addgene_135587 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GSP1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pPS293; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7816822
Comments: pPS293 has the GAL1 promoter (EcoRI/XbaI fragment) in YEp352 (2 micron ori).
Proper citation: RRID:Addgene_1357 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: QFGal4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2544; Vector Backbone:pDONR221; Vector Types:Gateway middle entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32697972
Comments: Can be recombined with any p5E vector containing a promoter to allow for tissue-specific expression of QFGal4. Note that an SV40pA is included after QFGal4.
Proper citation: RRID:Addgene_155118 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Orp1
Vector Backbone Description: Vector Backbone:pLenti6.2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_155042 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: QFGal4
Vector Backbone Description: Backbone Size:4053; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Expression in zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32697972
Comments: Can be linearized with NotI for in vitro synthesis of QFGal4
Proper citation: RRID:Addgene_155126 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: P2A-QFGal4
Vector Backbone Description: Backbone Marker:Karl J. Clark; Backbone Size:3310; Vector Backbone:pK; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32697972
Comments: pGTag series vectors were described in PMID: 32412410. pGTag-P2A-QFGal4-SV40 was modified from pGTag-eGFP-SV40 (Plasmid #117813).
Proper citation: RRID:Addgene_155127 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
