Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12039950
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23096 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12039950
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23097 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Tpa1
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20040577
Comments: This construct has a mutation causing N565D in the aa sequence. The depositor does know the effect of this mutation. However, it is not part of the active site.
Proper citation: RRID:Addgene_23140 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12620224
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23080 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23079 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23075 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9606197
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23076 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16329992
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23085 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12039950
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23087 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12620224
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23082 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16329992
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23084 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPS4
Vector Backbone Description: Backbone Size:5037; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443
Proper citation: RRID:Addgene_21495 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SNF7
Vector Backbone Description: Backbone Size:5549; Vector Backbone:pHis2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443
Proper citation: RRID:Addgene_21492 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VPS20
Vector Backbone Description: Backbone Size:5549; Vector Backbone:pHis2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19234443
Proper citation: RRID:Addgene_21490 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: polyA polymerase
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:Pet21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15909992
Comments: See attached purification scheme
Proper citation: RRID:Addgene_21716 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ura3
Vector Backbone Description: Backbone Marker:R. Kostriken; Backbone Size:2700; Vector Backbone:pRK113; Vector Types:integration sequence; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3065627
Comments: Constructed by inserting a HindIII URA3 fragment into the HindIII
site of the multiple cloning site of plasmid pRK113.
Contains the 117-bp HO cut site of
MATa inserted between the HincII and BamHI sites of pUC9 and the URA3 1.17-kb HindIII fragment at the HindlIl
site transcribed away from the HO cut site.
Proper citation: RRID:Addgene_21677 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Fus3-as2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRS406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19079053
Comments: There are several sequence discrepancies between depositor's sequence and Addgene sequence in the 5' UTR. The 5'UTR in the plasmid is from a W303-derived strain, and the SGD used S288C strain for genome sequencing, so the mismatches could be SNPs. This plasmid is functional and these mismatches do not affect the ORF.
Proper citation: RRID:Addgene_21789 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dig1-YFP
Vector Backbone Description: Backbone Size:3300; Vector Backbone:pACL7-YFP-A206K; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19079053
Comments: Construction was complicated; please refer to parent article's supplemental materials for details of construction.
Proper citation: RRID:Addgene_21788 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CDC3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11577116
Proper citation: RRID:Addgene_16252 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Impaired Edc3 binding sites (first HLM, and 5 additional HLMs in C-terminal domain).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163582 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
