Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
RPL25-GFP (94) Resource Report Resource Website 1+ mentions |
RRID:Addgene_24037 | RPL25 | Saccharomyces cerevisiae | Ampicillin | Entire RPL25 ORF inserted upstream of eGFP in EcoRI/HindIII of yEGFP3 | Backbone Size:5000; Vector Backbone:yEGFP3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:47:20 | 2 | ||
|
pTOPO-rRNA-5'ETS 923 to 1179 Resource Report Resource Website |
RRID:Addgene_23995 | rRNA 5'ETS ntds 923 to 1179 | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:15489292 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin | None | 2026-09-01 09:47:13 | 0 | |
|
pTOPO-25S rDNA Resource Report Resource Website |
RRID:Addgene_23996 | 25S rRNA from +5270 to oligo y | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:15489292 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin | none | 2026-09-01 09:47:13 | 0 | |
|
pTOPO-rRNA-5'ETS 1 to 177 Resource Report Resource Website |
RRID:Addgene_23993 | rDNA 5'ETS ntds 1 to 177 | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:15489292 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin and Kanamycin | None | 2026-09-01 09:47:13 | 0 | |
|
KAP123-FLU (116) Resource Report Resource Website |
RRID:Addgene_24048 | KAP123 | Saccharomyces cerevisiae | Ampicillin | KAP123 fused upstream of two FLU tags in BamHI/SalI of pBT024 | Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:47:21 | 0 | ||
|
pTOPO-rRNA-5‘ETS 347 to 631 Resource Report Resource Website |
RRID:Addgene_23994 | rRNA 5'ETS ntds 347 to 631 | Saccharomyces cerevisiae | Ampicillin | PMID:15489292 | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pTOPO; Vector Types:Bacterial Cloning - TOPO; Bacterial Resistance:Ampicillin | None | 2026-09-01 09:47:13 | 0 | |
|
NAB2NLS-GFP-PRA (107) Resource Report Resource Website |
RRID:Addgene_24043 | NAB2 | Saccharomyces cerevisiae | Ampicillin | NLS of NAB2 (bp 601-750) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242. PrA motif sequence downstream of GFP: GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC | Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Only bp 601-750 of NAB2 (NLS) | 2026-09-01 09:47:20 | 0 | |
|
PHO4NLS-GFP-PRA (109) Resource Report Resource Website |
RRID:Addgene_24044 | PHO4 | Saccharomyces cerevisiae | Ampicillin | NLS of PHO4 (bp 421-588) inserted in EcoRI/BamHI, eGFP inserted downstream in BamHI/HindIII and a single PrA repeat inserted further downstream in HindIII/SalI of pYX242. PrA motif sequence downstream of GFP: GCTCAACAAAATGCTTTTTATCAAGTCTTAAATATGCCTAACTTAAATGCTGATCAACGCAATGGTTTTATCCAAAGCCTTAAAGATGATCCAAGCCAAAGTGCTAACGTTTTAGGTGAAGCTCAAAAACTTAATGACTCTCAAGCTCCAAAAGCTGATGCGCAACAAAATAAC | Backbone Size:9000; Vector Backbone:pYX242; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Only bp 421-588 of PHO4 (NLS) | 2026-09-01 09:47:20 | 0 | |
|
KAP95-FLU (113) Resource Report Resource Website |
RRID:Addgene_24045 | KAP95 | Saccharomyces cerevisiae | Ampicillin | KAP95 fused upstream of two FLU tags in BamHI/SalI of pBT024 | Backbone Marker:Rosemary Williams (Rout Lab); Backbone Size:7100; Vector Backbone:pYEX-U (modified pYEX-BX); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:47:21 | 0 | ||
|
pGADT7-ADH700-yeCherry-pTEF1(ashbya)-yeGFP-DHFR Resource Report Resource Website |
RRID:Addgene_24585 | pADH1 yeCherry::pTEF1 (Ashbya)yeGFP-DHFR | Saccharomyces cerevisiae | Ampicillin | PMID:20017217 | Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1. Truncated version of ADH700 promoter (SbfI/SpeI) driven yeast enhanced RFP (SpeI/-). 2. promoter TEF1(Ashbya.) (SacII/BglII) driven yeast enhanced GFP fused to E.coli DHFR (BglII/XhoI) | 2026-09-01 09:48:37 | 0 | |
|
pGADT7-ADH700-yeCherry-pTEF1 (S.C.)-yeGFP-DHFR Resource Report Resource Website 1+ mentions |
RRID:Addgene_24584 | pADH1 yeCherry::pTEF1 (S.C.)yeGFP-DHFR | Saccharomyces cerevisiae | Ampicillin | PMID:20017217 | The TEF1 (S.C.) promoter region has 4 base differences from the published sequences but the authors report that they do not affect transcriptional function. | Backbone Size:6000; Vector Backbone:pGADT7; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1. Truncated version of ADH700 promoter (SbfI/SpeI) driven yeast enhanced RFP (SpeI/-). 2. promoter TEF1(S.C.) (SacII/BglII) driven yeast enhanced GFP fused to E.coli DHFR (BglII/XhoI) | 2026-09-01 09:48:37 | 1 |
|
pKS101 Resource Report Resource Website |
RRID:Addgene_24631 | FAA2 | Saccharomyces cerevisiae | Ampicillin | PMID:20111002 | Backbone Size:0; Vector Backbone:pBR322; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-09-01 09:48:44 | 0 | ||
|
pVP64 Resource Report Resource Website |
RRID:Addgene_22287 | REV1 | Saccharomyces cerevisiae | Ampicillin | PMID:19528320 | The REV1 ORF plus 1050 nucleotides (nt) of its upstream region that include the REV1 promoter and 500nt of the downstream region that include the REV1 transcription terminator was cloned in the vector YCplac111, which carries the LEU2 gene, the autonomous replicating sequence ARS1, and the centromeric CEN4 region. A BglII restriction site was added by site-directed mutagenesis right before the stop codon of REV1. A 33-mer oligonucleotide duplex containing the HA-coding sequence and a BamHI and a BglII restriction site was inserted into the BglII restriction site, adding an HA tag in fusion with REV1, and regenerating a unique BglII restriction site. This step was repeated three times in order to get four HA tags in fusion with REV1. | Backbone Size:6112; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:42:25 | 0 | |
|
pR5-19 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22288 | RAD5 | Saccharomyces cerevisiae | Ampicillin | PMID:18757916 | Mutation abolishes the ubiquitin ligase function | Backbone Size:6112; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | C914, C917->AA in the C3HC4 ring-finger motif | 2026-09-01 09:42:25 | 1 |
|
pR5-28 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22289 | RAD5 | Saccharomyces cerevisiae | Ampicillin | PMID:18757916 | Backbone Size:6112; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:42:25 | 1 | ||
|
pWZ414-F13 Resource Report Resource Website |
RRID:Addgene_23056 | yeast Histone H3-2 and Histone H4-2 | Saccharomyces cerevisiae | Ampicillin | PMID:9606197 | HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 | Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:44:33 | 0 | |
|
pWZ414-F15 Resource Report Resource Website |
RRID:Addgene_23064 | yeast Histone H3-2 and Histone H4-2 | Saccharomyces cerevisiae | Ampicillin | PMID:9606197 | HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 | Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Histone H4 deleted amino acids 4 - 19 | 2026-09-01 09:44:35 | 0 |
|
pWZ414-F33 Resource Report Resource Website |
RRID:Addgene_23068 | yeast Histone H3-2 and Histone H4-2 | Saccharomyces cerevisiae | Ampicillin | PMID:9606197 | HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 | Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Histone H4 changed Lysine 5 to Glutamine H4 K5Q | 2026-09-01 09:44:36 | 0 |
|
pWZ414-F23 Resource Report Resource Website |
RRID:Addgene_23065 | yeast Histone H3-2 and Histone H4-2 | Saccharomyces cerevisiae | Ampicillin | PMID:9606197 | HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 | Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III - Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Histone H4 changed Lysine 5 to Glutamine | 2026-09-01 09:44:35 | 0 |
|
pWZ414-F30 Resource Report Resource Website |
RRID:Addgene_23066 | yeast Histone H3-2 and Histone H4-2 | Saccharomyces cerevisiae | Ampicillin | PMID:9606197 | HHT2 is Yeast ID YNL031C HHF2 is Yeast ID YNL030W HHT2 is gene ID 855700 HHF2 is gene ID 855701 | Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Histone H3 changed lysine 9 to Glutamine H3 K9Q | 2026-09-01 09:44:35 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
