Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: VHL
Vector Backbone Description: Vector Backbone:pFC221K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238752 Copy
Species: Homo sapiens
Genetic Insert: PSMD3
Vector Backbone Description: Vector Backbone:pFN21A HaloTag(R) CMV Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_238750 Copy
Species: Homo sapiens
Genetic Insert: CHRM1
Vector Backbone Description: Vector Backbone:pBiT3.1-N [CMV/HiBiT/Blast] Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_236898 Copy
Species: Homo sapiens
Genetic Insert: PXDN
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236699 Copy
Species: Homo sapiens
Genetic Insert: PXDN
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236698 Copy
Species: Homo sapiens
Genetic Insert: CECR2
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236703 Copy
Species: Homo sapiens
Genetic Insert: CUL7
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236713 Copy
Species: Homo sapiens
Genetic Insert: CUL7
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pAAV-hSyn-EGFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_236712 Copy
Species: Homo sapiens
Genetic Insert: MAVS
Vector Backbone Description: Vector Backbone:pFN224C NanoLuc(R) CMV-Neo BiBRET-Balanced Vector and pFN222K HaloTag(R) CMV-Blast BiBRET Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_238826 Copy
Species: Homo sapiens
Genetic Insert: IRF5
Vector Backbone Description: Vector Backbone:pFN31K Nluc CMV-neo Flexi(R) Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_237150 Copy
Species: Mus musculus
Genetic Insert: Microexon E35a
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin
Comments: Microexon E35a sequence: gagacagagtcagatcaagatgatgag
Proper citation: RRID:Addgene_238353 Copy
Species: Homo sapiens
Genetic Insert: PRMT1
Vector Backbone Description: Backbone Size:7357; Vector Backbone:E2.pEF5-DEST-FL-V5-MCP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_155845 Copy
Species: Homo sapiens
Genetic Insert: HshnRNPH1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148142 Copy
Species: Homo sapiens
Genetic Insert: Hs4EHP-W95A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28698298
Comments: ORF extracted from NCBI:NM_004846 or UniProt.: O60573-1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148586 Copy
Vector Backbone Description: Backbone Marker:Naldini group; Vector Backbone:pMDLg.pRRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39804967
Comments: Please visit https://ssrn.com/abstract=4912248 for preprint.
Proper citation: RRID:Addgene_225570 Copy
Species: Synthetic
Genetic Insert: FlpO
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38915722
Proper citation: RRID:Addgene_230597 Copy
Species: Synthetic
Genetic Insert: FlpO
Vector Backbone Description: Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38915722
Proper citation: RRID:Addgene_230596 Copy
Vector Backbone Description: Vector Backbone:pSB; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187552 Copy
Vector Backbone Description: Vector Backbone:pCA; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187543 Copy
Vector Backbone Description: Vector Backbone:pCO; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32161816
Proper citation: RRID:Addgene_187549 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
