Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: empty sgRNA
Vector Backbone Description: Vector Backbone:R6K_; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32978126
Proper citation: RRID:Addgene_160080 Copy
Vector Backbone Description: Vector Backbone:PB-TAG-ERN; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33080218
Proper citation: RRID:Addgene_164521 Copy
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recB deletion verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
Proper citation: RRID:Addgene_176585 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2400; Vector Backbone:pDESTR4-R3; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24820376
Comments: See www.wormbuilder.org for updated protocols.
Proper citation: RRID:Addgene_51481 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2400; Vector Backbone:pDESTR4-R3; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24820376
Comments: See www.wormbuilder.org for updated protocols.
Proper citation: RRID:Addgene_51483 Copy
Vector Backbone Description: Backbone Size:6354; Vector Backbone:pDestTol2pA2 (Tol2Kit#394); Vector Types:CRISPR, Tol2 destination vector for Gateway; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25752963
Comments: Reference for the Tol2Kit:
Kwan, K.M., Fujimoto, E., Grabher, C., Mangum, B.D., Hardy, M.E., Campbell, D.S., Parant, J.M., Yost, H.J., Kanki, J.P., and Chien, C.B. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev Dyn 236, 3088-3099.
Proper citation: RRID:Addgene_63157 Copy
Species: V. cholerae
Genetic Insert: bottom toxin fragment from a HindIII digest of V. cholerae 395 chromosome
Vector Backbone Description: Vector Backbone:pBR325; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Kaper et. al. (1984) Bio/Technology 2:345
Proper citation: RRID:Addgene_63689 Copy
Species: V. cholerae
Genetic Insert: V. cholera chromosomal DNA
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Kaper et. al. 1986. Advances in Research on Cholera and Related Diarrheas, 3 eds., S. Kuwahara, N.F. Pierce, 181-191. Copyright 1986 by KTK Scientific Publishers, Tokyo
Proper citation: RRID:Addgene_63691 Copy
Species: Other
Genetic Insert: ehxA
Vector Backbone Description: Vector Backbone:pBR325; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:3298451
Comments: Also reference Schmidt et al. I&I 63:1055-1061
Proper citation: RRID:Addgene_63754 Copy
Vector Backbone Description: Backbone Marker:Mumberg D, et al. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 15; Backbone Size:7407; Vector Backbone:p414GPD; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25877921
Comments: Plasmid is a modified version of p414GPD from:
Mumberg D, et al. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156: 119-122, 1995. PubMed: 7737504
Proper citation: RRID:Addgene_63780 Copy
Species: Danio rerio
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Kwan et al., 2007; Vector Backbone:pDestTol2pA2; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23444339
Proper citation: RRID:Addgene_64023 Copy
Species: Synthetic
Genetic Insert: rTTA
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBR322; Vector Types:Mammalian Expression, Mouse Targeting, Tet Inducible; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24082130
Proper citation: RRID:Addgene_64103 Copy
Vector Backbone Description: Backbone Size:7083; Vector Backbone:pDestTol2LC; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25855067
Proper citation: RRID:Addgene_64241 Copy
Vector Backbone Description: Backbone Size:7083; Vector Backbone:pDestTol2LC; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25855067
Proper citation: RRID:Addgene_64242 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Life Technologies; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24656821
Proper citation: RRID:Addgene_53965 Copy
Vector Backbone Description: Backbone Marker:Geneart; Vector Backbone:pAMP (Genart); Vector Types:cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24551083
Comments: binary expression vector. LII/LIV backbone. ccdB cassettes (ccdB and chloramphenicol resistance gene) were added between the borders by Esp3I cut-ligation, flanked by appropriate type IIS fusion sites
Proper citation: RRID:Addgene_54369 Copy
Vector Backbone Description: Backbone Marker:Geneart; Vector Backbone:pAMP (Genart); Vector Types:cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24551083
Comments: binary expression vector. LII/LIV backbone. ccdB cassettes (ccdB and chloramphenicol resistance gene) were added between the borders by Esp3I cut-ligation, flanked by appropriate type IIS fusion sites
Proper citation: RRID:Addgene_54368 Copy
Vector Backbone Description: Backbone Marker:Geneart; Vector Backbone:pAMP (Genart); Vector Types:cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24551083
Comments: binary expression vector. LII/LIV backbone. ccdB cassettes (ccdB and chloramphenicol resistance gene) were added between the borders by Esp3I cut-ligation, flanked by appropriate type IIS fusion sites
Proper citation: RRID:Addgene_54372 Copy
Vector Backbone Description: Backbone Marker:Geneart; Vector Backbone:pAMP (Genart); Vector Types:cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24551083
Comments: binary expression vector. LII/LIV backbone. ccdB cassettes (ccdB and chloramphenicol resistance gene) were added between the borders by Esp3I cut-ligation, flanked by appropriate type IIS fusion sites
Proper citation: RRID:Addgene_54371 Copy
Vector Backbone Description: Backbone Marker:Geneart; Vector Backbone:pAMP (Genart); Vector Types:cloning vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24551083
Comments: binary expression vector. LII/LIV backbone. ccdB cassettes (ccdB and chloramphenicol resistance gene) were added between the borders by Esp3I cut-ligation, flanked by appropriate type IIS fusion sites
Proper citation: RRID:Addgene_54370 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.