Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:PMID: 7720076; Backbone Size:4885; Vector Backbone:injection vector pRN3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites.
Proper citation: RRID:Addgene_186370 Copy
Species: Homo sapiens
Genetic Insert: DRD2
Vector Backbone Description: Backbone Size:5601; Vector Backbone:pcDNA3.1+/Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39148292
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.03.467169v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_190752 Copy
Species: Synthetic
Genetic Insert: sfGFP in E1.3a format
Vector Backbone Description: Vector Backbone:pSEVA331; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34767345
Comments: Read the preprint at https://www.biorxiv.org/content/10.1101/2021.06.09.447691v1.full
Proper citation: RRID:Addgene_180551 Copy
Species: Homo sapiens
Genetic Insert: NODAL variant mature peptide
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.
Proper citation: RRID:Addgene_115265 Copy
Genetic Insert: T4 td upstream intron-PABP
Vector Backbone Description: Backbone Size:1882; Vector Backbone:pRC; Vector Types:Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851375
Proper citation: RRID:Addgene_189972 Copy
Species: Homo sapiens
Genetic Insert: NODAL
Vector Backbone Description: Backbone Marker:Su-Chun Zhang, Addgene plasmid #52344; Vector Backbone:AAVS1-CAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.
Proper citation: RRID:Addgene_115262 Copy
Species: Synthetic
Genetic Insert: mNeonGreen
Vector Backbone Description: Backbone Size:1882; Vector Backbone:pRC; Vector Types:Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851375
Proper citation: RRID:Addgene_189976 Copy
Species: Homo sapiens
Genetic Insert: NODAL
Vector Backbone Description: Backbone Marker:Paul Krieg, Addgene plasmid # 17091; Vector Backbone:T7TS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.
Proper citation: RRID:Addgene_115264 Copy
Species: Homo sapiens
Genetic Insert: AAVS1 homology arms with CMV-driven mRuby2-CAAX fusion
Vector Backbone Description: Backbone Marker:Thermo Fischer Scientific; Backbone Size:2974; Vector Backbone:pJET1.2; Vector Types:Mammalian Expression, CRISPR, Donor template; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36416720
Proper citation: RRID:Addgene_183871 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:PGK-DTAG-CTERM; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36127368
Proper citation: RRID:Addgene_185770 Copy
Vector Backbone Description: Backbone Marker:PMID: 14736459; Backbone Size:4774; Vector Backbone:PDONR-221 P1-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:17878951
Comments: Backbone was modified with ApaI (attP3) / EcoRI (attP5) and PstI (attP3) / EcoRV (attP5) sites
Proper citation: RRID:Addgene_186350 Copy
Species: Homo sapiens
Genetic Insert: NODAL
Vector Backbone Description: Backbone Marker:Origene; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Internal MYC tag at N-terminal end of mature peptide. C312 is involved in interchain disuflide bond formation (by similarity). Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.
Proper citation: RRID:Addgene_115256 Copy
Species: Homo sapiens
Genetic Insert: NODAL
Vector Backbone Description: Backbone Marker:Origene; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Internal MYC tag at N-terminal end of mature peptide. NODAL mature peptide is truncated at the end of exon 2. Contains insert (cloning artifact) downstream of stop codon. Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.
Proper citation: RRID:Addgene_115257 Copy
Species: Homo sapiens
Genetic Insert: DPYSL2
Vector Backbone Description: Backbone Size:7438; Vector Backbone:pLJC2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35575798
Proper citation: RRID:Addgene_189866 Copy
Species: Homo sapiens
Genetic Insert: NODAL
Vector Backbone Description: Backbone Marker:Origene; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: C312 is involved in interchain disuflide bond formation (by similarity) . Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.
Proper citation: RRID:Addgene_115253 Copy
Species: Homo sapiens
Genetic Insert: signal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site
Vector Backbone Description: Backbone Marker:PMID: 14736459; Backbone Size:2544; Vector Backbone:PDONR-221 P1-P2; Vector Types:Expression of a fluorescent membrane marker; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17878951
Proper citation: RRID:Addgene_186355 Copy
Species: E. coli
Genetic Insert: Retron Eco1 Reverse Transcriptase
Vector Backbone Description: Vector Backbone:pJKR-O-mphR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35896746
Comments: A192P mutation in mphR codon optimized does not affect plasmid function.
Please visit https://doi.org/10.1101/2021.08.11.455990 for bioRxiv preprint.
Proper citation: RRID:Addgene_187202 Copy
Species: Homo sapiens
Genetic Insert: Pleckstrin Homology domain of PLCD1
Vector Backbone Description: Backbone Marker:PMID: 14736459; Backbone Size:2544; Vector Backbone:PDONR-221 P1-P2; Vector Types:Protein expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_186354 Copy
Vector Backbone Description: Backbone Marker:PMID: 14736459; Backbone Size:4768; Vector Backbone:PDONR-221 P1-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:17878951
Comments: Backbone was modified with ApaI (attP3) / EcoRI (attP4) and PstI (attP3) / EcoRV (attP4) sites
Proper citation: RRID:Addgene_186351 Copy
Species: Homo sapiens
Genetic Insert: BLK_E3-3_gRNA
Vector Backbone Description: Vector Backbone:pSPgRNA (Addgene #47108); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36160011
Proper citation: RRID:Addgene_124484 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
