Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 40 showing 781 ~ 800 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_120882

    This resource has 1+ mentions.

http://www.addgene.org/120882

Species: Synthetic
Genetic Insert: Cas12i1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC

Proper citation: RRID:Addgene_120882 Copy   


  • RRID:Addgene_120870

    This resource has 1+ mentions.

http://www.addgene.org/120870

Species: Synthetic
Genetic Insert: pcDNA3-fLuc=tdT
Vector Backbone Description: Backbone Size:5297; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650390

Proper citation: RRID:Addgene_120870 Copy   


  • RRID:Addgene_120873

    This resource has 1+ mentions.

http://www.addgene.org/120873

Species: Synthetic
Genetic Insert: Cas12c2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5355; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC

Proper citation: RRID:Addgene_120873 Copy   


  • RRID:Addgene_120833

    This resource has 1+ mentions.

http://www.addgene.org/120833

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5535; Vector Backbone:pcDNA3.2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29572905

Proper citation: RRID:Addgene_120833 Copy   


  • RRID:Addgene_120825

    This resource has 1+ mentions.

http://www.addgene.org/120825

Species: Other
Genetic Insert: NS5 ZIKV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5535; Vector Backbone:pcDNA3.2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29572905

Proper citation: RRID:Addgene_120825 Copy   


  • RRID:Addgene_120933

    This resource has 1+ mentions.

http://www.addgene.org/120933

Species: Homo sapiens
Genetic Insert: PD-L1-EGFP
Vector Backbone Description: Vector Backbone:pGIPZ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29959401

Proper citation: RRID:Addgene_120933 Copy   


  • RRID:Addgene_120912

    This resource has 1+ mentions.

http://www.addgene.org/120912

Genetic Insert: FKBP-V5-AP-NES
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30848125

Proper citation: RRID:Addgene_120912 Copy   


  • RRID:Addgene_120915

    This resource has 1+ mentions.

http://www.addgene.org/120915

Genetic Insert: EX-HA-FRB-Cb5
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30848125

Proper citation: RRID:Addgene_120915 Copy   


  • RRID:Addgene_120918

    This resource has 1+ mentions.

http://www.addgene.org/120918

Genetic Insert: NLS-MCP-AP
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30848125

Proper citation: RRID:Addgene_120918 Copy   


  • RRID:Addgene_120903

    This resource has 1+ mentions.

http://www.addgene.org/120903

Species: Mus musculus
Genetic Insert: ptch1
Vector Backbone Description: Vector Backbone:pcDNA-h; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30415841

Proper citation: RRID:Addgene_120903 Copy   


  • RRID:Addgene_12096

    This resource has 1+ mentions.

http://www.addgene.org/12096

Species: Homo sapiens
Genetic Insert: Sp1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3319186
Comments: See author's map for more information. This particular clone corresponds to the first 4237 nucleotides of GenBank reference sequence NM_138473.2 and contains the entire coding sequence of Sp1.

Proper citation: RRID:Addgene_12096 Copy   


  • RRID:Addgene_12098

    This resource has 1+ mentions.

http://www.addgene.org/12098

Species: Homo sapiens
Genetic Insert: Sp1
Vector Backbone Description: Backbone Size:3700; Vector Backbone:modified pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: RSV LTR driving expression of Sp1. See author's map for more information.

Proper citation: RRID:Addgene_12098 Copy   


  • RRID:Addgene_12092

    This resource has 1+ mentions.

http://www.addgene.org/12092

Species: Homo sapiens
Genetic Insert: p53 (NES-)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10980695

Proper citation: RRID:Addgene_12092 Copy   


  • RRID:Addgene_121054

    This resource has 1+ mentions.

http://www.addgene.org/121054

Species: Caenorhabditis elegans
Genetic Insert: GFP^SEC^AID*::3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33677541
Comments: This plasmid is derived from pDD282 (AddGene plasmid 66823)

Proper citation: RRID:Addgene_121054 Copy   


  • RRID:Addgene_121057

    This resource has 1+ mentions.

http://www.addgene.org/121057

Species: Caenorhabditis elegans
Genetic Insert: mKate2-T^SEC^AID*::3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33677541
Comments: This plasmid is derived from pDD285 (AddGene plasmid 66826)

Proper citation: RRID:Addgene_121057 Copy   


  • RRID:Addgene_12100

    This resource has 10+ mentions.

http://www.addgene.org/12100

Species: Homo sapiens
Genetic Insert: AP-2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3500; Vector Backbone:SP72; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2010091
Comments: See author's map for more information.

Proper citation: RRID:Addgene_12100 Copy   


  • RRID:Addgene_12108

    This resource has 10+ mentions.

http://www.addgene.org/12108

Genetic Insert: LacZ
Vector Backbone Description: Backbone Size:6670; Vector Backbone:n/a; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11553794

Proper citation: RRID:Addgene_12108 Copy   


http://www.addgene.org/121180

Species: Synthetic
Genetic Insert: Hygro-P2A-mAID-mCherry
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31026591

Proper citation: RRID:Addgene_121180 Copy   


http://www.addgene.org/121182

Species: Synthetic
Genetic Insert: BSD-P2A-mAID-mClover
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31026591

Proper citation: RRID:Addgene_121182 Copy   


http://www.addgene.org/121184

Species: Synthetic
Genetic Insert: CMV-OsTIR1-loxP-PURO-loxP
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31026591
Comments: This plasmid is a variant of Addgene plasmid 72834.

Proper citation: RRID:Addgene_121184 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X