Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Cas12i1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC
Proper citation: RRID:Addgene_120882 Copy
Species: Synthetic
Genetic Insert: pcDNA3-fLuc=tdT
Vector Backbone Description: Backbone Size:5297; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650390
Proper citation: RRID:Addgene_120870 Copy
Species: Synthetic
Genetic Insert: Cas12c2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5355; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC
Proper citation: RRID:Addgene_120873 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5535; Vector Backbone:pcDNA3.2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29572905
Proper citation: RRID:Addgene_120833 Copy
Species: Other
Genetic Insert: NS5 ZIKV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5535; Vector Backbone:pcDNA3.2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29572905
Proper citation: RRID:Addgene_120825 Copy
Species: Homo sapiens
Genetic Insert: PD-L1-EGFP
Vector Backbone Description: Vector Backbone:pGIPZ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29959401
Proper citation: RRID:Addgene_120933 Copy
Genetic Insert: FKBP-V5-AP-NES
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30848125
Proper citation: RRID:Addgene_120912 Copy
Genetic Insert: EX-HA-FRB-Cb5
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30848125
Proper citation: RRID:Addgene_120915 Copy
Genetic Insert: NLS-MCP-AP
Vector Backbone Description: Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30848125
Proper citation: RRID:Addgene_120918 Copy
Species: Mus musculus
Genetic Insert: ptch1
Vector Backbone Description: Vector Backbone:pcDNA-h; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30415841
Proper citation: RRID:Addgene_120903 Copy
Species: Homo sapiens
Genetic Insert: Sp1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3319186
Comments: See author's map for more information.
This particular clone corresponds to the first 4237 nucleotides of GenBank reference sequence NM_138473.2 and contains the entire coding sequence of Sp1.
Proper citation: RRID:Addgene_12096 Copy
Species: Homo sapiens
Genetic Insert: Sp1
Vector Backbone Description: Backbone Size:3700; Vector Backbone:modified pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: RSV LTR driving expression of Sp1. See author's map for more information.
Proper citation: RRID:Addgene_12098 Copy
Species: Homo sapiens
Genetic Insert: p53 (NES-)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10980695
Proper citation: RRID:Addgene_12092 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP^SEC^AID*::3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33677541
Comments: This plasmid is derived from pDD282 (AddGene plasmid 66823)
Proper citation: RRID:Addgene_121054 Copy
Species: Caenorhabditis elegans
Genetic Insert: mKate2-T^SEC^AID*::3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33677541
Comments: This plasmid is derived from pDD285 (AddGene plasmid 66826)
Proper citation: RRID:Addgene_121057 Copy
Species: Homo sapiens
Genetic Insert: AP-2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3500; Vector Backbone:SP72; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2010091
Comments: See author's map for more information.
Proper citation: RRID:Addgene_12100 Copy
Genetic Insert: LacZ
Vector Backbone Description: Backbone Size:6670; Vector Backbone:n/a; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11553794
Proper citation: RRID:Addgene_12108 Copy
Species: Synthetic
Genetic Insert: Hygro-P2A-mAID-mCherry
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31026591
Proper citation: RRID:Addgene_121180 Copy
Species: Synthetic
Genetic Insert: BSD-P2A-mAID-mClover
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31026591
Proper citation: RRID:Addgene_121182 Copy
Species: Synthetic
Genetic Insert: CMV-OsTIR1-loxP-PURO-loxP
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31026591
Comments: This plasmid is a variant of Addgene plasmid 72834.
Proper citation: RRID:Addgene_121184 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.