Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Biorientation of chromosomes in cell division 1-like
Vector Backbone Description: Backbone Marker:Thermo Scientific (CloneJET PCR Cloning Kit); Backbone Size:2974; Vector Backbone:pJET1.2/blunt; Vector Types:In situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31169497
Proper citation: RRID:Addgene_124443 Copy
Species: Mus musculus
Genetic Insert: PU.1 ETS domain (residues 167-272)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30295801
Proper citation: RRID:Addgene_124435 Copy
Species: Mus musculus
Genetic Insert: NK3 homeobox 2
Vector Backbone Description: Backbone Marker:Thermo Scientific (CloneJET PCR Cloning Kit); Backbone Size:2974; Vector Backbone:pJET1.2/blunt; Vector Types:In situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31169497
Proper citation: RRID:Addgene_124437 Copy
Species: Mus musculus
Genetic Insert: NK3 homeobox 2
Vector Backbone Description: Backbone Marker:Thermo Scientific (CloneJET PCR Cloning Kit); Backbone Size:2974; Vector Backbone:pJET1.2/blunt; Vector Types:In situ probe; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31169497
Proper citation: RRID:Addgene_124438 Copy
Species: Mus musculus
Genetic Insert: Nedd4-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12907674
Proper citation: RRID:Addgene_11206 Copy
Species: Mus musculus
Genetic Insert: (Arkadia)Rnf111
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pTriEx2-hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17341133
Comments: The GFP tagged Arkadia constructs were generated by eliminating the first 9 aa of Arkadia and fusing in frame to GFP Sequences and cloned into SmaI/XhoI of the pTriEx2-hygro (Novagen, http://www.novagen.com) vector.
Proper citation: RRID:Addgene_112228 Copy
Species: Mus musculus
Genetic Insert: (Arkadia)Rnf111
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pTriEx2-hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17341133
Comments: The GFP tagged Arkadia constructs were generated by eliminating the first 9 aa of Arkadia and fusing in frame to GFP Sequences and cloned into SmaI/XhoI of the pTriEx2-hygro (Novagen, http://www.novagen.com) vector.
Proper citation: RRID:Addgene_112229 Copy
Species: Mus musculus
Genetic Insert: MPND
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:pET30a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30982744
Proper citation: RRID:Addgene_112226 Copy
Species: Mus musculus
Genetic Insert: shRNA against mouse HDAC3
Vector Backbone Description: Vector Backbone:pRNATU6.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112272 Copy
Species: Mus musculus
Genetic Insert: protein kinase c gamma
Vector Backbone Description: Backbone Size:4718; Vector Backbone:mEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30013171
Proper citation: RRID:Addgene_112270 Copy
Species: Mus musculus
Genetic Insert: shRNA negative control
Vector Backbone Description: Vector Backbone:pRNATU6.1neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112273 Copy
Species: Mus musculus
Genetic Insert: Nuclear Factor I B2
Vector Backbone Description: Vector Backbone:pCAGG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112700 Copy
Species: Mus musculus
Genetic Insert: Nuclear Factor I B2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112703 Copy
Species: Mus musculus
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Feng Zhang; Backbone Size:4574; Vector Backbone:PX552; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29706865
Comments: gRNA targeting mouse Gsk3b gene was cloned into the plasmid PX552 received from Dr. Feng Zhang.
Proper citation: RRID:Addgene_112733 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5078; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: For more information about this plasmid, see Mukherjee et al. 2014 PLoS Biol (10.1371/journal.pbio.1001933). The insert sequence of this plasmid was subcloned from pcDNA3-bio-myc-NES-mCEΔNLS described in this publication.
Additional internal sequencing primers:
IntCE1-F: GAATGCCCCACCACTGAGAATACTG
IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC
IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC
Proper citation: RRID:Addgene_112711 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the guanylyltransferase domain of RNGTT.
Proper citation: RRID:Addgene_112716 Copy
Species: Mus musculus
Genetic Insert: Rngtt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30166341
Comments: This plasmid encodes the triphosphatase domain of RNGTT.
Proper citation: RRID:Addgene_112715 Copy
Species: Mus musculus
Genetic Insert: Nuclear Factor I X2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_112704 Copy
Species: Mus musculus
Genetic Insert: Catulin-alpha-1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899
Proper citation: RRID:Addgene_112841 Copy
Species: Mus musculus
Genetic Insert: Catulin-alpha-1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1(+)/Puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26769899
Proper citation: RRID:Addgene_112843 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
