Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: GFP plus
Vector Backbone Description: Backbone Size:3725; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34471126
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.279141v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_172718 Copy
Species: Pseudomonas aeruginosa SG17M
Genetic Insert: disaggregase ClpG with 6xHis-tag
Vector Backbone Description: Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29263094
Proper citation: RRID:Addgene_126502 Copy
Vector Backbone Description: Vector Backbone:pHAtC; Vector Types:Plant Expression, Plant Binary vector; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32190101
Proper citation: RRID:Addgene_169765 Copy
Species: Pseudoalteromonas translucida
Genetic Insert: PtrTniQ, PtrCas5/8, PtrCas7, PtrCas6, CRISPR(BsaI)
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34478496
Proper citation: RRID:Addgene_175579 Copy
Species: Homo sapiens
Genetic Insert: Replication factor C subunit 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32907938
Proper citation: RRID:Addgene_175043 Copy
Species: Homo sapiens
Genetic Insert: SAE1
Vector Backbone Description: Backbone Marker:Novagen - lab stock; Backbone Size:3600; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34035521
Proper citation: RRID:Addgene_175241 Copy
Species: Synthetic
Genetic Insert: LuxR-mRFP
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:original Duet vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_172557 Copy
Species: Synthetic
Genetic Insert: Csm1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3419; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31278272
Proper citation: RRID:Addgene_128572 Copy
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:20350301
Comments: F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZ M15 ΔlacX74 deoR recA1 endA1 araD139 Δ(ara, leu) 7649 galU galK rspL nupG [ λcI857 (cro-bioA) < > araC-PBADtrfA]
Proper citation: RRID:Addgene_24545 Copy
Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29991261
Comments: Esherichia coli strain that expresses rat APOBEC1. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth rApo1]
Proper citation: RRID:Addgene_156459 Copy
Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29991261
Comments: Esherichia coli strain that expresses MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth MutaT7]
Proper citation: RRID:Addgene_156460 Copy
Species: Discosoma
Genetic Insert: tdTomato
Vector Backbone Description: Vector Backbone:pMV361-strep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32829077
Comments: tdTomato: Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein
Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry
(2004). Nature Biotechnology, 22(12) , 1567-1572. doi: 10.1038/nbt1037.
Proper citation: RRID:Addgene_140994 Copy
Species: Homo sapiens
Genetic Insert: ACE2
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Comments: BC039902
Proper citation: RRID:Addgene_149719 Copy
Species: Pseudomonas sp. 101
Genetic Insert: formate dehydrogenase
Vector Backbone Description: Backbone Marker:Expressys; Backbone Size:1799; Vector Backbone:pZE21-MCS; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31778652
Proper citation: RRID:Addgene_131706 Copy
Species: Synthetic
Genetic Insert: Cph1(1-514,Y263F)-RGD-His6-Cys
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31526004
Proper citation: RRID:Addgene_131861 Copy
Vector Backbone Description: Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:35998606
Proper citation: RRID:Addgene_188972 Copy
Genetic Insert: GUSPlus::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170833 Copy
Genetic Insert: FRO6p::GUSPlus::tOCS
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:36216814
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170840 Copy
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Species: Other
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89730 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
