Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:streptomycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

228 Results - per page

Show More Columns | Download 228 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGV3341
 
Resource Report
Resource Website 		RRID:Addgene_170279 HIV-2 RT p66 (mutant) HIV-2 Streptomycin PMID:34082799 Please visit https://www.medrxiv.org/content/10.1101/2020.08.13.20173757v4 for medRxiv preprint Backbone Marker:Novagen; Backbone Size:3498; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 12:51:56 0
pGV3319
 
Resource Report
Resource Website 		RRID:Addgene_170277 Bst-LF D720A Bacillus stearothermophilus Streptomycin PMID:34082799 Please visit https://www.medrxiv.org/content/10.1101/2020.08.13.20173757v4 for medRxiv preprint Backbone Marker:Novagen; Backbone Size:3543; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin D720A 2026-09-05 12:51:56 0
pCDF-1b-RFC140ΔN555
 
Resource Report
Resource Website 		RRID:Addgene_175043 Replication factor C subunit 1 Homo sapiens Streptomycin PMID:32907938 Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 12:52:37 0
SAE1
 
Resource Report
Resource Website 		RRID:Addgene_175241 SAE1 Homo sapiens Streptomycin PMID:34035521 Backbone Marker:Novagen - lab stock; Backbone Size:3600; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 12:52:39 0
pPROBE-OT
 
Resource Report
Resource Website 		RRID:Addgene_37820 Promotorless gfp reporter gene bacteria Streptomycin PMID:11059491 Please refer to the attached table for a complete list of restriction sites in the MCS. Vector Backbone:pBBR1; Vector Types:; Bacterial Resistance:Streptomycin 2026-09-05 12:55:49 0
pJK543
 
Resource Report
Resource Website 		RRID:Addgene_72516 formylglycinamidine ribonucleotide synthetase, small subunit Acetobacter aceti 1023 Streptomycin pCloDF13 replicon Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin contains additional Ala2 2026-09-05 01:00:44 0
pJK544
 
Resource Report
Resource Website 		RRID:Addgene_72517 formylglycinamidine ribonucleotide synthetase, small subunit Acetobacter aceti 1023 Streptomycin pCloDF13 replicon Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin contains additional Ala2 2026-09-05 01:00:44 0
pJK549
 
Resource Report
Resource Website 		RRID:Addgene_72520 formylglycinamidine ribonucleotide synthetase, large subunit Acetobacter aceti 1023 Streptomycin pCloDF13 replicon Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 01:00:44 0
pJK550
 
Resource Report
Resource Website 		RRID:Addgene_72450 N5-carboxyaminoimidazole ribonucleotide mutase Acetobacter aceti 1023 Streptomycin CDF ori Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin inserted Val2 2026-09-05 01:00:44 0
pJK547
 
Resource Report
Resource Website 		RRID:Addgene_72449 N5-carboxyaminoimidazole ribonucleotide synthetase Acetobacter aceti 1023 Streptomycin CDF ori Backbone Size:3781; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin Val319 to Phe 2026-09-05 01:00:44 0
pCas1+2
 
Resource Report
Resource Website 		RRID:Addgene_72676 Cas1, Cas2 from K12 genome Streptomycin PMID:22402487 Backbone Marker:Novagen; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 01:00:46 0
pGMCS-0X-P38-PanBmGFP
 
Resource Report
Resource Website 		RRID:Addgene_27127 PanB Mycobacterium tuberculosis Streptomycin PMID:20711362 Backbone Size:5400; Vector Backbone:pGMCS; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 12:54:38 0
DHL708
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98417 Genotype: MC4100 ∆clpPX Streptomycin PMID:27732583 Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20). The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC. Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012). Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin 2026-09-05 01:03:46 1
pOxyR_gfp
 
Resource Report
Resource Website 		RRID:Addgene_194154 transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP E. coli Streptomycin PMID:34820092 Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 01:06:06 0
pOxyR_rfp
 
Resource Report
Resource Website 		RRID:Addgene_194155 transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry E. coli Streptomycin PMID:34820092 Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 01:06:06 0
pCDF-His-mTET1CD
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_81053 TET1 Mus musculus Streptomycin PMID:26932196 Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin catalytic domain amino acid 1367-2057 2026-09-05 01:02:01 1
pCDF-His-mTET1CD∆cat
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_81054 TET1 Mus musculus Streptomycin PMID:26932196 Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin catalytic domain amino acid 1367-2057 with histidine 1652 and aspartic acid 1654 changed to tyrosine and alanine, respectively 2026-09-05 01:02:01 1
pAN4036
 
Resource Report
Resource Website 		RRID:Addgene_74698 PPhlF-PBetI-YFP E. coli Streptomycin PMID:27034378 Backbone Marker:Alec Nielsen; Backbone Size:3359; Vector Backbone:pAN4020; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 01:01:04 0
pSH424-ssr
 
Resource Report
Resource Website 		RRID:Addgene_198026 T0 terminator - Sm resistance cassette Synthetic Streptomycin PMID:37798358 Backbone Size:4948; Vector Backbone:pSH624-ssr; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-09-05 01:08:50 0
pCDF-casBCDE(-6)
 
Resource Report
Resource Website 		RRID:Addgene_89730 CRISPR array Other Streptomycin PMID:27738137 Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin Derivative CRISPR array containing a shorter version of the wt spacer (-6) truncated by 6 nucleotides at the leader-distal end. 2026-09-05 01:03:12 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join NIH's “It's About Time: Temporal Reasoning in Biomedical Knowledge Graphs Challenge”

dkNET community events and announcements in September, 2026

dkNET community events and announcements in August, 2026

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch