Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Pvalb-2A-Flpo
Vector Backbone Description: Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25741722
Proper citation: RRID:Addgene_61572 Copy
Species: Homo sapiens
Genetic Insert: HER2/neu receptor specific humanized Gamma 4 heavy chain expression cassette
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:25073855
Proper citation: RRID:Addgene_61887 Copy
Species: Homo sapiens
Genetic Insert: grass pollen allergen Phl p 7 specific human Mu heavy chain expression cassette
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:6491; Vector Backbone:pVITRO1-hygro-mcs; Vector Types:Mammalian Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:25073855
Proper citation: RRID:Addgene_61880 Copy
Vector Backbone Description: Backbone Size:5767; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty destination vector. It is a polycistronic vector that can express up to five genes at once. Genes must first be cloned into any of our 8-series transfer vectors (8BT,8CT,8UT), then subcloned into any of the five cassettes of the destination vector:
Cassette 1: BamHI/XbaI
Cassette 2: AsiSI/PspXI
Cassette 3: SbfI/AscI
Cassette 4: AdeI/NotI
Cassette 5: PacI/FseI
Please note that you must always insert your gene into the lowest cassette number first (e.g., if you're using cassettes 2 and 3, you must put your gene into cassette 2 first, then move on to cassette 3). You do not have to use all of the cassettes.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48282 Copy
Vector Backbone Description: Backbone Size:6906; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8CT adds a TEV-cleavable His6-MBP tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48280 Copy
Vector Backbone Description: Backbone Size:5706; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8UT adds a MYFQSNA tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.
Proper citation: RRID:Addgene_48281 Copy
Vector Backbone Description: Backbone Size:5742; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.8BT adds a TEV-cleavable His6 tag to the N-terminus of your protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48279 Copy
Species: Homo sapiens
Genetic Insert: Malic Enzyme 1
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23334421
Proper citation: RRID:Addgene_49163 Copy
Species: Homo sapiens
Genetic Insert: Rab6AQ72LdeltaCSC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49558 Copy
Species: Homo sapiens
Genetic Insert: Rab1AQ70L
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49555 Copy
Species: Homo sapiens
Genetic Insert: Rab6BAQ72LdeltaCSC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49559 Copy
Species: Homo sapiens
Genetic Insert: Rab11A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49553 Copy
Species: Homo sapiens
Genetic Insert: Rab10T23N
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20345488
Proper citation: RRID:Addgene_49545 Copy
Species: Homo sapiens
Genetic Insert: Rab13
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20345488
Comments: The discrepancies between the QC and full sequence should not affect plasmid function.
Proper citation: RRID:Addgene_49548 Copy
Species: Homo sapiens
Genetic Insert: Rab8
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20345488
Proper citation: RRID:Addgene_49543 Copy
Species: Homo sapiens
Genetic Insert: Rab3A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20345488
Proper citation: RRID:Addgene_49542 Copy
Species: Homo sapiens
Genetic Insert: Rab1AQ70L
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20345488
Proper citation: RRID:Addgene_49537 Copy
Species: Homo sapiens
Genetic Insert: Rab10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14500507
Comments: BamHI/XhoI fragment encoding Rab10 cloned into BglII/SalI site of EGFP C1
Proper citation: RRID:Addgene_49472 Copy
Species: Homo sapiens
Genetic Insert: Rab6B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14500507
Proper citation: RRID:Addgene_49470 Copy
Species: Homo sapiens
Genetic Insert: Rab4AS22N
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16926431
Comments: ** Note, this mutation corresponds to S27A in the full length Rab4A
Proper citation: RRID:Addgene_49476 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
